ID: 1121741098

View in Genome Browser
Species Human (GRCh38)
Location 14:96252884-96252906
Sequence GGTCCTGGGTGCTGGCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 2, 2: 6, 3: 68, 4: 523}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741098_1121741103 -10 Left 1121741098 14:96252884-96252906 CCCCAGAGCCAGCACCCAGGACC 0: 1
1: 2
2: 6
3: 68
4: 523
Right 1121741103 14:96252897-96252919 ACCCAGGACCCTTCACTTCTGGG 0: 1
1: 0
2: 4
3: 13
4: 190
1121741098_1121741110 8 Left 1121741098 14:96252884-96252906 CCCCAGAGCCAGCACCCAGGACC 0: 1
1: 2
2: 6
3: 68
4: 523
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741098_1121741106 -6 Left 1121741098 14:96252884-96252906 CCCCAGAGCCAGCACCCAGGACC 0: 1
1: 2
2: 6
3: 68
4: 523
Right 1121741106 14:96252901-96252923 AGGACCCTTCACTTCTGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 131
1121741098_1121741109 2 Left 1121741098 14:96252884-96252906 CCCCAGAGCCAGCACCCAGGACC 0: 1
1: 2
2: 6
3: 68
4: 523
Right 1121741109 14:96252909-96252931 TCACTTCTGGGCTGGCTGCCAGG 0: 1
1: 0
2: 1
3: 38
4: 244
1121741098_1121741111 18 Left 1121741098 14:96252884-96252906 CCCCAGAGCCAGCACCCAGGACC 0: 1
1: 2
2: 6
3: 68
4: 523
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121741098 Original CRISPR GGTCCTGGGTGCTGGCTCTG GGG (reversed) Intronic