ID: 1121741099

View in Genome Browser
Species Human (GRCh38)
Location 14:96252885-96252907
Sequence GGGTCCTGGGTGCTGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 479}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741099_1121741106 -7 Left 1121741099 14:96252885-96252907 CCCAGAGCCAGCACCCAGGACCC 0: 1
1: 0
2: 5
3: 61
4: 479
Right 1121741106 14:96252901-96252923 AGGACCCTTCACTTCTGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 131
1121741099_1121741110 7 Left 1121741099 14:96252885-96252907 CCCAGAGCCAGCACCCAGGACCC 0: 1
1: 0
2: 5
3: 61
4: 479
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741099_1121741109 1 Left 1121741099 14:96252885-96252907 CCCAGAGCCAGCACCCAGGACCC 0: 1
1: 0
2: 5
3: 61
4: 479
Right 1121741109 14:96252909-96252931 TCACTTCTGGGCTGGCTGCCAGG 0: 1
1: 0
2: 1
3: 38
4: 244
1121741099_1121741111 17 Left 1121741099 14:96252885-96252907 CCCAGAGCCAGCACCCAGGACCC 0: 1
1: 0
2: 5
3: 61
4: 479
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121741099 Original CRISPR GGGTCCTGGGTGCTGGCTCT GGG (reversed) Intronic