ID: 1121741100

View in Genome Browser
Species Human (GRCh38)
Location 14:96252886-96252908
Sequence AGGGTCCTGGGTGCTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 417}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741100_1121741111 16 Left 1121741100 14:96252886-96252908 CCAGAGCCAGCACCCAGGACCCT 0: 1
1: 0
2: 1
3: 30
4: 417
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741100_1121741109 0 Left 1121741100 14:96252886-96252908 CCAGAGCCAGCACCCAGGACCCT 0: 1
1: 0
2: 1
3: 30
4: 417
Right 1121741109 14:96252909-96252931 TCACTTCTGGGCTGGCTGCCAGG 0: 1
1: 0
2: 1
3: 38
4: 244
1121741100_1121741106 -8 Left 1121741100 14:96252886-96252908 CCAGAGCCAGCACCCAGGACCCT 0: 1
1: 0
2: 1
3: 30
4: 417
Right 1121741106 14:96252901-96252923 AGGACCCTTCACTTCTGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 131
1121741100_1121741110 6 Left 1121741100 14:96252886-96252908 CCAGAGCCAGCACCCAGGACCCT 0: 1
1: 0
2: 1
3: 30
4: 417
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121741100 Original CRISPR AGGGTCCTGGGTGCTGGCTC TGG (reversed) Intronic