ID: 1121741101

View in Genome Browser
Species Human (GRCh38)
Location 14:96252892-96252914
Sequence AAGTGAAGGGTCCTGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741101_1121741111 10 Left 1121741101 14:96252892-96252914 CCAGCACCCAGGACCCTTCACTT 0: 1
1: 0
2: 2
3: 18
4: 269
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741101_1121741115 29 Left 1121741101 14:96252892-96252914 CCAGCACCCAGGACCCTTCACTT 0: 1
1: 0
2: 2
3: 18
4: 269
Right 1121741115 14:96252944-96252966 CTGGAGCTGCCTGAATGCCCAGG 0: 1
1: 1
2: 5
3: 61
4: 823
1121741101_1121741110 0 Left 1121741101 14:96252892-96252914 CCAGCACCCAGGACCCTTCACTT 0: 1
1: 0
2: 2
3: 18
4: 269
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741101_1121741109 -6 Left 1121741101 14:96252892-96252914 CCAGCACCCAGGACCCTTCACTT 0: 1
1: 0
2: 2
3: 18
4: 269
Right 1121741109 14:96252909-96252931 TCACTTCTGGGCTGGCTGCCAGG 0: 1
1: 0
2: 1
3: 38
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121741101 Original CRISPR AAGTGAAGGGTCCTGGGTGC TGG (reversed) Intronic