ID: 1121741102

View in Genome Browser
Species Human (GRCh38)
Location 14:96252896-96252918
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741091_1121741102 26 Left 1121741091 14:96252847-96252869 CCAGTGGAGCTTTATCTGCTAAG 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1121741102 14:96252896-96252918 CACCCAGGACCCTTCACTTCTGG 0: 1
1: 0
2: 0
3: 25
4: 201
1121741096_1121741102 -8 Left 1121741096 14:96252881-96252903 CCACCCCAGAGCCAGCACCCAGG 0: 1
1: 1
2: 5
3: 58
4: 606
Right 1121741102 14:96252896-96252918 CACCCAGGACCCTTCACTTCTGG 0: 1
1: 0
2: 0
3: 25
4: 201
1121741095_1121741102 -7 Left 1121741095 14:96252880-96252902 CCCACCCCAGAGCCAGCACCCAG 0: 1
1: 0
2: 5
3: 74
4: 590
Right 1121741102 14:96252896-96252918 CACCCAGGACCCTTCACTTCTGG 0: 1
1: 0
2: 0
3: 25
4: 201
1121741094_1121741102 -3 Left 1121741094 14:96252876-96252898 CCTTCCCACCCCAGAGCCAGCAC 0: 1
1: 0
2: 4
3: 72
4: 602
Right 1121741102 14:96252896-96252918 CACCCAGGACCCTTCACTTCTGG 0: 1
1: 0
2: 0
3: 25
4: 201
1121741090_1121741102 27 Left 1121741090 14:96252846-96252868 CCCAGTGGAGCTTTATCTGCTAA 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1121741102 14:96252896-96252918 CACCCAGGACCCTTCACTTCTGG 0: 1
1: 0
2: 0
3: 25
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type