ID: 1121741108 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:96252906-96252928 |
| Sequence | GGCAGCCAGCCCAGAAGTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 287 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 30, 4: 254} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1121741108_1121741115 | 15 | Left | 1121741108 | 14:96252906-96252928 | CCTTCACTTCTGGGCTGGCTGCC | 0: 1 1: 0 2: 2 3: 30 4: 254 |
||
| Right | 1121741115 | 14:96252944-96252966 | CTGGAGCTGCCTGAATGCCCAGG | 0: 1 1: 1 2: 5 3: 61 4: 823 |
||||
| 1121741108_1121741111 | -4 | Left | 1121741108 | 14:96252906-96252928 | CCTTCACTTCTGGGCTGGCTGCC | 0: 1 1: 0 2: 2 3: 30 4: 254 |
||
| Right | 1121741111 | 14:96252925-96252947 | TGCCAGGCCATGGCAGCACCTGG | 0: 1 1: 0 2: 1 3: 55 4: 502 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1121741108 | Original CRISPR | GGCAGCCAGCCCAGAAGTGA AGG (reversed) | Intronic | ||