ID: 1121741110

View in Genome Browser
Species Human (GRCh38)
Location 14:96252915-96252937
Sequence CTGGGCTGGCTGCCAGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 10, 3: 56, 4: 513}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741095_1121741110 12 Left 1121741095 14:96252880-96252902 CCCACCCCAGAGCCAGCACCCAG 0: 1
1: 0
2: 5
3: 74
4: 590
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741101_1121741110 0 Left 1121741101 14:96252892-96252914 CCAGCACCCAGGACCCTTCACTT 0: 1
1: 0
2: 2
3: 18
4: 269
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741099_1121741110 7 Left 1121741099 14:96252885-96252907 CCCAGAGCCAGCACCCAGGACCC 0: 1
1: 0
2: 5
3: 61
4: 479
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741104_1121741110 -6 Left 1121741104 14:96252898-96252920 CCCAGGACCCTTCACTTCTGGGC 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741096_1121741110 11 Left 1121741096 14:96252881-96252903 CCACCCCAGAGCCAGCACCCAGG 0: 1
1: 1
2: 5
3: 58
4: 606
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741094_1121741110 16 Left 1121741094 14:96252876-96252898 CCTTCCCACCCCAGAGCCAGCAC 0: 1
1: 0
2: 4
3: 72
4: 602
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741100_1121741110 6 Left 1121741100 14:96252886-96252908 CCAGAGCCAGCACCCAGGACCCT 0: 1
1: 0
2: 1
3: 30
4: 417
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741098_1121741110 8 Left 1121741098 14:96252884-96252906 CCCCAGAGCCAGCACCCAGGACC 0: 1
1: 2
2: 6
3: 68
4: 523
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513
1121741105_1121741110 -7 Left 1121741105 14:96252899-96252921 CCAGGACCCTTCACTTCTGGGCT 0: 1
1: 0
2: 0
3: 25
4: 275
Right 1121741110 14:96252915-96252937 CTGGGCTGGCTGCCAGGCCATGG 0: 1
1: 0
2: 10
3: 56
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121741110 Original CRISPR CTGGGCTGGCTGCCAGGCCA TGG Intronic