ID: 1121741111

View in Genome Browser
Species Human (GRCh38)
Location 14:96252925-96252947
Sequence TGCCAGGCCATGGCAGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 502}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741094_1121741111 26 Left 1121741094 14:96252876-96252898 CCTTCCCACCCCAGAGCCAGCAC 0: 1
1: 0
2: 4
3: 72
4: 602
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741100_1121741111 16 Left 1121741100 14:96252886-96252908 CCAGAGCCAGCACCCAGGACCCT 0: 1
1: 0
2: 1
3: 30
4: 417
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741095_1121741111 22 Left 1121741095 14:96252880-96252902 CCCACCCCAGAGCCAGCACCCAG 0: 1
1: 0
2: 5
3: 74
4: 590
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741104_1121741111 4 Left 1121741104 14:96252898-96252920 CCCAGGACCCTTCACTTCTGGGC 0: 1
1: 0
2: 1
3: 20
4: 205
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741101_1121741111 10 Left 1121741101 14:96252892-96252914 CCAGCACCCAGGACCCTTCACTT 0: 1
1: 0
2: 2
3: 18
4: 269
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741099_1121741111 17 Left 1121741099 14:96252885-96252907 CCCAGAGCCAGCACCCAGGACCC 0: 1
1: 0
2: 5
3: 61
4: 479
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741096_1121741111 21 Left 1121741096 14:96252881-96252903 CCACCCCAGAGCCAGCACCCAGG 0: 1
1: 1
2: 5
3: 58
4: 606
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741105_1121741111 3 Left 1121741105 14:96252899-96252921 CCAGGACCCTTCACTTCTGGGCT 0: 1
1: 0
2: 0
3: 25
4: 275
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741108_1121741111 -4 Left 1121741108 14:96252906-96252928 CCTTCACTTCTGGGCTGGCTGCC 0: 1
1: 0
2: 2
3: 30
4: 254
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741098_1121741111 18 Left 1121741098 14:96252884-96252906 CCCCAGAGCCAGCACCCAGGACC 0: 1
1: 2
2: 6
3: 68
4: 523
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502
1121741107_1121741111 -3 Left 1121741107 14:96252905-96252927 CCCTTCACTTCTGGGCTGGCTGC 0: 1
1: 0
2: 3
3: 17
4: 262
Right 1121741111 14:96252925-96252947 TGCCAGGCCATGGCAGCACCTGG 0: 1
1: 0
2: 1
3: 55
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121741111 Original CRISPR TGCCAGGCCATGGCAGCACC TGG Intronic