ID: 1121741297

View in Genome Browser
Species Human (GRCh38)
Location 14:96254131-96254153
Sequence CTGTGCTTGATGAAGTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121741297_1121741302 24 Left 1121741297 14:96254131-96254153 CCAGGGGACTTCATCAAGCACAG 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1121741302 14:96254178-96254200 CCAAACCTTATAGAGGCTGTGGG 0: 1
1: 0
2: 0
3: 4
4: 86
1121741297_1121741299 17 Left 1121741297 14:96254131-96254153 CCAGGGGACTTCATCAAGCACAG 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1121741299 14:96254171-96254193 GGTTTAACCAAACCTTATAGAGG 0: 1
1: 0
2: 1
3: 3
4: 45
1121741297_1121741298 -4 Left 1121741297 14:96254131-96254153 CCAGGGGACTTCATCAAGCACAG 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1121741298 14:96254150-96254172 ACAGCACACATCAGACTGTAAGG 0: 1
1: 0
2: 0
3: 61
4: 1329
1121741297_1121741300 23 Left 1121741297 14:96254131-96254153 CCAGGGGACTTCATCAAGCACAG 0: 1
1: 0
2: 1
3: 13
4: 150
Right 1121741300 14:96254177-96254199 ACCAAACCTTATAGAGGCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121741297 Original CRISPR CTGTGCTTGATGAAGTCCCC TGG (reversed) Intronic
903311234 1:22458221-22458243 CTGTGCTTTATAAAGACCACTGG - Intronic
903620621 1:24695622-24695644 GTGTTCTTCATTAAGTCCCCAGG + Intergenic
904089839 1:27937091-27937113 CTGTGCTTCAGGAAGACACCTGG - Intronic
905397082 1:37673835-37673857 CTTTGTTTGATGAAGACCCTGGG + Intergenic
905645539 1:39622869-39622891 CTCTCCTTGATGAGGTCTCCAGG + Intergenic
908348401 1:63259666-63259688 CTGTGCTCCATGAAGTCCTCAGG - Intergenic
910468297 1:87523758-87523780 CTGTGCTGGCTGAAATCCCGGGG - Intergenic
911228791 1:95337618-95337640 CTGTGATTGATGAGGTCTGCCGG + Intergenic
911242916 1:95484503-95484525 GTATGCTTCATGAAGTTCCCAGG - Intergenic
913298045 1:117341185-117341207 CCTTACTTCATGAAGTCCCCAGG + Intergenic
914339116 1:146743245-146743267 CTCTGCTTGCTGATGGCCCCTGG + Intergenic
916432198 1:164741633-164741655 CAGTGCTTTAATAAGTCCCCTGG + Intronic
918915677 1:190633990-190634012 CTGTGTTTGCTGAAGACCCTAGG + Intergenic
920264255 1:204710155-204710177 CTGTGCTTGAAGAAGCTCTCTGG - Intergenic
920275632 1:204802391-204802413 CTGTGCTTGATTAAGTCTAGAGG + Intergenic
921056763 1:211548464-211548486 CTGTGTTTGGGAAAGTCCCCTGG + Intergenic
923990857 1:239435510-239435532 TTGTACTTGATGAAATCCCAAGG + Intronic
1063284296 10:4666879-4666901 CTTTCCTTGATGAATTGCCCTGG + Intergenic
1064670935 10:17713276-17713298 CCGGGCTTCATGAGGTCCCCTGG - Intronic
1067147355 10:43703150-43703172 CTCTGCTTTATGAAGACACCGGG + Intergenic
1067754920 10:48998401-48998423 CTGTTCTTGAATAAGTTCCCAGG + Intergenic
1067784087 10:49229859-49229881 CTCTGCTTGAGGAATTCCACAGG - Intergenic
1069068919 10:63974387-63974409 CAGTGCTTGATGAAGGCCGTCGG + Intergenic
1069898394 10:71693126-71693148 CTGTGATTGCTGAAGTCTGCTGG + Intronic
1070959835 10:80490858-80490880 CTGTGCATGATCATGTCCCCAGG - Intronic
1071288325 10:84169441-84169463 CTCTGGTTGATGAAGTGCCAGGG + Intergenic
1075305284 10:121362374-121362396 CTGTGCCTGAAGAAGGCCTCTGG - Intergenic
1075443892 10:122500721-122500743 CTGTGCTGAATGAGGCCCCCAGG - Intronic
1075554053 10:123416786-123416808 CTGTGTTTAATGCAGTCTCCCGG + Intergenic
1077174203 11:1181306-1181328 GTGTGGTAGATGACGTCCCCTGG - Intronic
1077479009 11:2804255-2804277 CTGTGCTTGCTGATGTGCCGAGG - Intronic
1079573678 11:21976518-21976540 CTGTGCCTTATAAAGACCCCAGG - Intergenic
1080823048 11:35825157-35825179 CTTTCCCTCATGAAGTCCCCAGG - Intergenic
1081365966 11:42235446-42235468 CTTTGCTACATAAAGTCCCCTGG + Intergenic
1083668724 11:64288849-64288871 CTGTACTAGGTGAGGTCCCCTGG + Intronic
1084571837 11:69964587-69964609 CAGTGCCTGAGGAAGTGCCCGGG - Intergenic
1092071486 12:5634925-5634947 ATGTTCTTGATCAAGTCCTCTGG - Intronic
1094851805 12:34385622-34385644 CTGTGCATGACGAAGTCCCAGGG - Intergenic
1100551482 12:95650196-95650218 CTGTGCAGGATGAAGTCGACAGG + Intergenic
1101594560 12:106152566-106152588 CTGTGCTTCATGCACTCCACTGG + Intergenic
1104247253 12:127055794-127055816 CTGTGCTTGATGAAGGCAGAGGG - Intergenic
1104814011 12:131635583-131635605 CAGCGTTTGATGAAGTCTCCAGG - Intergenic
1113280280 13:108780990-108781012 CTGTGCTTAAAGAAGTCATCAGG - Intronic
1114388436 14:22279895-22279917 CTGTACTTTAAGAAGTCCTCCGG + Intergenic
1114696958 14:24634327-24634349 CTCTGCCTGATGACGTCCTCTGG + Intergenic
1121169650 14:91842870-91842892 CAGTGCATGATGAAGTCCTGGGG - Intronic
1121741297 14:96254131-96254153 CTGTGCTTGATGAAGTCCCCTGG - Intronic
1122961444 14:105095582-105095604 CTGTCCTGGAGGAAGTCCCAAGG - Intergenic
1125185123 15:36921254-36921276 CTGTGATTGATGTAATCCTCAGG - Intronic
1128732877 15:70033058-70033080 CTGTGCTTTCTCCAGTCCCCTGG - Intergenic
1129950086 15:79578367-79578389 CTGGTCTTGATGAAGTCACAGGG - Intergenic
1131636199 15:94235412-94235434 CTGTGCTTTAAGAAGCCCTCCGG + Intronic
1132745544 16:1434722-1434744 ATGTCCTTGATGAAGACCCGCGG + Exonic
1132990678 16:2791276-2791298 CAGTGCTTGGCCAAGTCCCCCGG - Intergenic
1134207595 16:12250578-12250600 CAGAGCTTGATGCAGTCCTCGGG + Intronic
1135565133 16:23506188-23506210 CTGAGCTACATGAAGTCACCAGG - Intronic
1139489337 16:67278345-67278367 CTGTGCCTGTTGTAATCCCCAGG + Exonic
1139995162 16:70974107-70974129 CTCTGCTTGCTGATGGCCCCTGG - Intronic
1140710927 16:77676952-77676974 CAGTGCTTAATGAAGTACCTGGG - Intergenic
1141574086 16:84952986-84953008 CTGTACTTTGGGAAGTCCCCAGG - Intergenic
1144660651 17:17067078-17067100 TTGTGCGTGATGAAGTGCCCAGG - Intronic
1144855326 17:18264304-18264326 CTGTGCTTGTGGCAGTCCCTGGG + Exonic
1145110926 17:20160458-20160480 CTCTGCTTGATGCAGTCCCCTGG - Intronic
1146661426 17:34667543-34667565 GTGTGTTTGCTGAAGCCCCCAGG + Intergenic
1149231362 17:54537593-54537615 CTATGCTTGCTCAAGGCCCCAGG - Intergenic
1150409863 17:64934381-64934403 CTGTGCCTGTGGAAGTCCCTTGG - Intergenic
1152615779 17:81337170-81337192 CTGGGCTGGATGGGGTCCCCAGG - Intergenic
1154124577 18:11678844-11678866 CTGTGCTTGAAGAGTTCCCTGGG - Intergenic
1154228600 18:12532243-12532265 CTGTGCTTTATAAAGTAGCCAGG + Intronic
1154228701 18:12533703-12533725 CTGTGCTTTATAAAGTAGCCAGG + Intronic
1155302973 18:24449497-24449519 CTGTTCTGGTTGAAGTCACCAGG + Intronic
1161266729 19:3367591-3367613 CTGGGCTGGAAGGAGTCCCCGGG - Intronic
1161468856 19:4446533-4446555 GTGAGGTTGAAGAAGTCCCCAGG + Exonic
1163459815 19:17430254-17430276 CCTTGCGTGATGCAGTCCCCAGG - Intronic
926964490 2:18395328-18395350 CAGTGCTTTAACAAGTCCCCAGG + Intergenic
927890661 2:26746101-26746123 CTGTGCTTTTCGAATTCCCCTGG + Intergenic
929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG + Intergenic
929784877 2:44982235-44982257 CTGTGCTTGAATAAGCCTCCAGG - Intergenic
930714798 2:54583137-54583159 CGCTGCTTGGTGATGTCCCCTGG + Intronic
930924617 2:56802042-56802064 CTGTGCTTTATCAACTCCCCTGG - Intergenic
932526692 2:72477037-72477059 CTGTCAATGTTGAAGTCCCCTGG + Intronic
933389333 2:81651155-81651177 CTGTGGTTGATGAAATGCCACGG + Intergenic
935524102 2:104144493-104144515 CTGTGCTTGAAGAAGTATCAAGG - Intergenic
936041062 2:109149959-109149981 GGGTGCATGTTGAAGTCCCCTGG + Intronic
937199677 2:120192200-120192222 GTCTGCTTGATGGAGTCCCATGG - Intergenic
938472902 2:131582159-131582181 CCGTGTTTGATGAAGTACTCCGG - Intergenic
939582590 2:143968132-143968154 CTGTGCAAGATGAAGTGCCATGG + Intronic
947660409 2:231862257-231862279 CTGTGGTTGAAGAAGCCTCCTGG + Intergenic
948972539 2:241440526-241440548 CTGTGCTTTTGGAAGGCCCCAGG + Intronic
1169332183 20:4724717-4724739 CCTTGCTTGATGAAGGCTCCCGG - Exonic
1171448714 20:25221892-25221914 CTGTGCCTGATGCGGCCCCCCGG - Intronic
1172102713 20:32495179-32495201 CTGTGGCTGAGGAAGTGCCCAGG - Intronic
1173590667 20:44222363-44222385 CTGTCCTTGAGGATGTCCCCTGG + Intergenic
1175021608 20:55857097-55857119 CCATGCATGATGAAATCCCCAGG + Intergenic
1175630578 20:60532270-60532292 CTGTGCTGGAGGAACTCCCTAGG + Intergenic
1181318319 22:21985458-21985480 CTCTGCTTCCTGAAGTCCCATGG - Intergenic
1181558724 22:23687275-23687297 CTGTTTTTGATGAGCTCCCCAGG + Intergenic
1184856993 22:47151751-47151773 CTGGGGTTGAAGAAGACCCCTGG + Intronic
1185010761 22:48312534-48312556 CTGTGCCTGGTGCACTCCCCTGG + Intergenic
1185227901 22:49663655-49663677 CTGTCCCTGATGAAGTTGCCTGG - Intergenic
954799744 3:53180473-53180495 CAGTGCTGGCAGAAGTCCCCTGG + Intronic
956265467 3:67391776-67391798 CTGTGTCTGATGATGTCCCCTGG + Intronic
960447831 3:117769417-117769439 CTGTGACTAATGAAGACCCCAGG + Intergenic
960659747 3:120044461-120044483 CTCTGCTTGATGAAATGCCAGGG - Intronic
961470113 3:127106184-127106206 CAGGGCTGCATGAAGTCCCCAGG + Intergenic
961916826 3:130384660-130384682 CTGTGCTTAATGAAGTGTGCAGG + Intronic
962414955 3:135173523-135173545 CAGTGCTTGAGGAAGAACCCAGG - Intronic
966840843 3:184086025-184086047 CTCTGCTTTGTGAAGTCCTCAGG - Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
968505427 4:969037-969059 CTGTGCTAGCTGGAGGCCCCAGG + Intronic
968714886 4:2149390-2149412 CTGCCATTGATGAATTCCCCTGG - Intronic
968908704 4:3466033-3466055 CTGAGCTGGATGAAGCCCCCAGG - Intronic
969422173 4:7103803-7103825 CTCAGCTTGAGGAAGTCCTCGGG + Intergenic
969604126 4:8193808-8193830 CTGTGAGGGATGCAGTCCCCAGG + Intronic
970145992 4:13036340-13036362 TTGTGCTTGCTGAAGAACCCTGG + Intergenic
972288004 4:37666973-37666995 CTGTCCCGGCTGAAGTCCCCTGG + Intronic
975459407 4:74632969-74632991 CTGGGCTTGATGAAGCCTGCTGG - Intergenic
975523674 4:75326799-75326821 GTGTGCTTGATGATGACCCTTGG - Intergenic
977792409 4:101123338-101123360 GTGAACTTGATGAAGTCTCCTGG + Intronic
982171983 4:152671097-152671119 CTTTGCTTGAAGAACTCCCAAGG - Intronic
983311608 4:166070591-166070613 CTGTCCTTGAGCAAGTCCCTAGG - Intronic
986070714 5:4279806-4279828 CTTTGCTTGATTAAGTGCCAGGG - Intergenic
986422483 5:7598854-7598876 CTCTGCTTAATGAAGGCACCTGG - Intronic
993470307 5:88299603-88299625 ATGTGCTTGATCATGTTCCCTGG + Intergenic
994446229 5:99878769-99878791 CTGTGGTTGAAGGAGTCCCCTGG - Intergenic
999443800 5:151622783-151622805 CTGTGGTTGAGCAAGTCCCATGG + Intergenic
1000939218 5:167339957-167339979 CTGTGCTTTATAAATTACCCAGG + Intronic
1001018777 5:168165314-168165336 CTGTGCTCAATGAAATCGCCAGG - Intronic
1006488864 6:34368408-34368430 CTTTGCTTTATGAGGTCTCCTGG - Intronic
1009737256 6:67691960-67691982 CCTTGCTTGATGAAGTCTCAGGG - Intergenic
1010028955 6:71252744-71252766 CTGTGGCTGATGAAATCTCCAGG + Intergenic
1014721297 6:124920957-124920979 TGGTGCTTTGTGAAGTCCCCTGG - Intergenic
1015030511 6:128588587-128588609 CTGGTATTGATGAAGTCCCTCGG - Intergenic
1016324182 6:142880709-142880731 CTCTCTTTGATCAAGTCCCCAGG + Intronic
1016908327 6:149173017-149173039 CTGTGACTGCTGAAGTCCCCAGG + Intergenic
1019363139 7:616211-616233 CTGTGCTGGAGGCAGCCCCCTGG + Intronic
1019879864 7:3849173-3849195 CTGTTCTTGAACAAATCCCCTGG + Intronic
1024193815 7:47039149-47039171 ATGTTCATGATGATGTCCCCTGG - Intergenic
1024236267 7:47401547-47401569 CTGGGGTTCATGAGGTCCCCAGG + Intronic
1030346180 7:108435407-108435429 GTGTGCTTGATGTTGTCCCATGG - Intronic
1030406464 7:109120782-109120804 GTTTGCTTTATGAAGACCCCTGG - Intergenic
1033656698 7:143380382-143380404 CTGCGCTTGGTGGAGACCCCGGG - Intergenic
1035075550 7:156175089-156175111 CTGTGCGGGATGTGGTCCCCAGG - Intergenic
1038880872 8:31609958-31609980 CTGTGCTGTAAGAAGTCCACAGG + Intergenic
1040996329 8:53406419-53406441 GTGTGCTGGAAGAAGTCACCTGG - Intergenic
1045196755 8:99940351-99940373 CTGTGCTTGATGGTGTCCCTTGG + Intergenic
1046129840 8:109954043-109954065 CTCTGCCTGAGAAAGTCCCCAGG - Intergenic
1047763713 8:127972834-127972856 CTGTGCTTCTTGAAGCTCCCAGG + Intergenic
1049289180 8:141792442-141792464 CTGTGCTCCATGGAGCCCCCAGG + Intergenic
1056064595 9:82920933-82920955 CTGAGCTTCATGAAGGCACCAGG + Intergenic
1057012450 9:91617143-91617165 CAGTGCTTCCTGAAGACCCCAGG + Intronic
1057879470 9:98782241-98782263 TGGTGCTGGAGGAAGTCCCCGGG + Intronic
1059751014 9:117247372-117247394 CCATCATTGATGAAGTCCCCAGG + Intronic
1060264102 9:122100319-122100341 CTGTGGTTGATTCAGTCCCCTGG + Intergenic
1060863108 9:126972596-126972618 CTGTGTCTGATGAAGTCCCTGGG + Intronic
1189003204 X:36967427-36967449 GTGTGCTTGATGTATTCCACTGG - Intergenic
1189833724 X:45000421-45000443 CTCTGGTTGATGAAGTGCCAGGG + Intronic
1190072194 X:47288677-47288699 CTGTCCTAGAAGGAGTCCCCTGG + Intergenic
1190412193 X:50147790-50147812 TTGTGCTTGATCATGTTCCCTGG - Intergenic
1191946764 X:66542746-66542768 CTGTTGTTGATGAAATCCCTTGG + Intergenic
1192194241 X:69018055-69018077 CTGTGCTGGATGTGGGCCCCAGG - Intergenic
1194943420 X:100040473-100040495 TTTTGCTTGATGAACCCCCCCGG + Intergenic
1195570233 X:106392401-106392423 CTGTGCTAAGTGAAGCCCCCAGG + Intergenic
1195740310 X:108058709-108058731 CTGTTCTTGATGAACTACGCAGG - Intronic
1197457857 X:126700387-126700409 CTGTGGTTCATGTTGTCCCCAGG - Intergenic