ID: 1121743059

View in Genome Browser
Species Human (GRCh38)
Location 14:96267378-96267400
Sequence TCCCCACAGCTGCACGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121743053_1121743059 10 Left 1121743053 14:96267345-96267367 CCAAGACACTTGGGGGAATGGGG 0: 1
1: 0
2: 1
3: 51
4: 986
Right 1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG 0: 1
1: 0
2: 0
3: 20
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121743059 Original CRISPR TCCCCACAGCTGCACGGGAA GGG Intronic
902214043 1:14923761-14923783 TCCCCACAGCTGACCGGGAGAGG - Intronic
904607174 1:31704269-31704291 TGCCCAGAGCTGCCCTGGAAGGG + Exonic
904770556 1:32878858-32878880 TCCCCACAGCAGCTCTGCAAGGG + Intergenic
904823058 1:33257537-33257559 TCCTCAGAGCTGCGCGGGATGGG + Intronic
905410651 1:37765744-37765766 TCCCGGGAGCTGCTCGGGAAAGG + Intergenic
906597413 1:47091871-47091893 TTCCCACAGCAGGACCGGAAGGG - Intronic
907337484 1:53709937-53709959 TCCCCACAGATGTACAGGATGGG + Intronic
908250038 1:62258521-62258543 TCTCTTCAGCTGAACGGGAAAGG - Intronic
911796978 1:102088272-102088294 TCCGCACAGCTGAAAAGGAAGGG - Intergenic
914827134 1:151144622-151144644 TGCCCAGAGATGCAGGGGAAGGG + Intronic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
922809474 1:228407638-228407660 TCCCCAAAGTTGCACGAGCAGGG - Intergenic
923019384 1:230151196-230151218 TCCAGAAAGCTGCAGGGGAATGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923805320 1:237251332-237251354 TCCCCACAGCTCCACTGAAATGG + Intronic
924043783 1:240008715-240008737 TAGGCACAGCTGCTCGGGAAAGG + Intergenic
1070346552 10:75548415-75548437 TCCTCACTGTTGCATGGGAAAGG - Intronic
1070512760 10:77176355-77176377 TCACTGCAGCTGCACAGGAAGGG + Intronic
1071293346 10:84202544-84202566 TGCCCATAGCTGCACGGGCTGGG + Intronic
1072687989 10:97550084-97550106 TCCCAACAGCTGGCCGGCAAGGG - Intronic
1075336070 10:121609612-121609634 TCACCACAGCTGCCCTGGAGAGG + Intergenic
1075678959 10:124318821-124318843 TCCCCAGAGATTCAAGGGAAGGG - Intergenic
1076161518 10:128247562-128247584 TCCCCACAACTACATGGGCAAGG + Intergenic
1076233814 10:128848168-128848190 TCCCCAAAGCTTGACGTGAATGG + Intergenic
1076320714 10:129579453-129579475 TCCTGACAGCTGCACAGAAACGG - Intronic
1077059553 11:611834-611856 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077059567 11:611873-611895 TCCCGACAGCTCCCCGGGCATGG - Exonic
1077744584 11:4887939-4887961 TCCCCACAGCCTCATGGGGAAGG - Intronic
1080663284 11:34314556-34314578 TGCACACAGCTGCAAGGGAGAGG + Intronic
1081812116 11:45920034-45920056 TCTCCACAGCTGCAGAGGGAGGG - Intergenic
1086739536 11:90350816-90350838 TCCCCACAGCTGGGCGGCAAGGG - Intergenic
1089118315 11:116113825-116113847 TCCACACACCTGCACAGGATAGG + Intergenic
1089800695 11:121024428-121024450 TCCCCACAGCTGCTCGAGACAGG - Intronic
1094382615 12:29859526-29859548 TCCCCACAACTGAAGGGAAATGG + Intergenic
1096875446 12:54626567-54626589 TCACCAGAGCAGCACAGGAAAGG - Intergenic
1101180973 12:102217785-102217807 TCCCCACACCTGGCCGGGCACGG + Intergenic
1103407571 12:120686853-120686875 ATCCCACAGCTGAATGGGAAAGG - Exonic
1103931642 12:124453803-124453825 TCCCCACAGCTGGGCTGGAGGGG + Intronic
1105633902 13:22199023-22199045 TGCCCACAGCTGCACAAGTAAGG - Intergenic
1106702362 13:32244033-32244055 CCCCCACAGCTGCTGGAGAAGGG + Exonic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1108609151 13:52067430-52067452 TGCCCACAGCTGCACAGATAAGG + Intronic
1110709996 13:78640226-78640248 TCCCCACATCTACAGGGGATTGG + Intronic
1112567733 13:100565743-100565765 TCCCCACAGCTGGACAGGCAGGG - Intronic
1113952201 13:114078189-114078211 GCCCCACAGCTGAGCGGGACGGG + Intronic
1120730483 14:87995515-87995537 TACCCACAGCTGCACAGATAAGG - Intergenic
1121152411 14:91647695-91647717 TCACCAGAACAGCACGGGAAAGG + Intronic
1121427120 14:93860281-93860303 TCCTCACAGCTGCCCTGGAAGGG + Intergenic
1121554126 14:94823511-94823533 TGCCCACAGCTAGACGGGGAGGG - Intergenic
1121743059 14:96267378-96267400 TCCCCACAGCTGCACGGGAAGGG + Intronic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1122997116 14:105271343-105271365 GCCCCGCAGCTGCACAGCAAGGG + Intronic
1202852433 14_GL000225v1_random:30099-30121 TCCCCACGGAAGCCCGGGAACGG + Intergenic
1124364574 15:29062884-29062906 TCCCCACAGCCCCACGAGATGGG - Intronic
1126157205 15:45576768-45576790 TCCTCACAGGTGCTTGGGAAAGG - Intergenic
1128309373 15:66620920-66620942 ACCCCACAGCTGCCCTGGGAAGG + Intronic
1128554365 15:68621121-68621143 TCCCTACACCTGCACTGGCAGGG - Intronic
1129364807 15:75047693-75047715 TCCTCACAGCTGCCCAGGGAGGG + Intronic
1129827275 15:78641903-78641925 TCCCCCCACCCGCAAGGGAATGG - Intronic
1130055574 15:80522223-80522245 TCACAACAGCTGCATGGAAAGGG + Intronic
1130225663 15:82056529-82056551 TCCCCACAGATGCGGAGGAAGGG + Intergenic
1130804319 15:87302649-87302671 TCCACAAAGCTGCATGAGAATGG - Intergenic
1130917141 15:88314019-88314041 TCTGCACAGCTGCATGGGATTGG - Intergenic
1131667830 15:94589305-94589327 TCCACCCAGCTGCAAGGGGAGGG - Intergenic
1132691351 16:1183176-1183198 TTCCCACAGCCGCACGGGGGTGG - Intronic
1132803260 16:1764287-1764309 ACACCACAGCTGCAAGGGCAGGG - Exonic
1132861078 16:2072066-2072088 TCCCTGCAGCTGCTCGGGGAAGG - Intronic
1133172230 16:3988456-3988478 CCCCCACACCTGCCCTGGAAGGG - Intronic
1133172240 16:3988482-3988504 CCCCCACACCTGCCCTGGAAGGG - Intronic
1133857645 16:9564723-9564745 TCCCTCCATCTGCACTGGAAGGG - Intergenic
1133930570 16:10228953-10228975 TCCCCAGAGCAGAACAGGAAGGG + Intergenic
1134328428 16:13228344-13228366 TCCCCCCATCTGCACGGATATGG + Intronic
1136552172 16:30987634-30987656 TCCCCACAGCAGCCTGGGAAAGG - Intronic
1141682479 16:85552765-85552787 TCCCCACTGCAGCAGGGGAAGGG + Intergenic
1142163479 16:88571432-88571454 TCCCAACTACTGAACGGGAAAGG - Intronic
1143147390 17:4785651-4785673 TCGCCCCAGCTGCAAGGCAAAGG + Exonic
1144824142 17:18096226-18096248 TCCCCAAAGCGGCATGGCAAGGG - Intronic
1146540341 17:33688060-33688082 TCCCCACAGATGCAGGGAGAGGG + Intronic
1147835686 17:43329907-43329929 TCCCCACAGGTTAACAGGAATGG + Intergenic
1147837389 17:43344125-43344147 TCCCCACAGGTTAACAGGAATGG + Intergenic
1151834585 17:76574444-76574466 CCCCCACAGCAGCACTGGAATGG + Exonic
1151946553 17:77323003-77323025 GCCCTACAGCTGCCCAGGAAGGG + Intronic
1152208983 17:78992983-78993005 TGCCCACAGCTGCACAGGCCAGG - Exonic
1153514130 18:5889777-5889799 TGCCCACAGCTGCTTGCGAATGG - Exonic
1158697432 18:59715450-59715472 TCCAGACAGCTGCAGGGAAAAGG - Intergenic
1160561118 18:79756227-79756249 TCCCCACCGCTGCATGGGGGCGG - Exonic
1163648189 19:18502130-18502152 GCCCCACAGCTCCACGGGGCAGG + Intronic
1165078401 19:33293679-33293701 GCCCAACATGTGCACGGGAAAGG + Intergenic
1166512292 19:43417112-43417134 TTCCCACTGCTGCACGAGAACGG + Intronic
1166945184 19:46391872-46391894 TCCACACAGCTCCACGGGAGAGG - Intronic
1167674682 19:50877024-50877046 TCCCAACATCTGGAGGGGAAAGG + Intronic
1168573829 19:57491778-57491800 GCCCCACAGCTGTGCAGGAAAGG + Intronic
1168575439 19:57504967-57504989 GCCCCACAGCTGTGCAGGAAAGG + Intronic
925033525 2:670270-670292 GCTCCACAGCTGCACTGGGAAGG + Intronic
925194183 2:1910131-1910153 TCCCTACAGCAGCAGGGGCAGGG - Intronic
925901299 2:8511155-8511177 TCCCCACAGCTGCAGGGGGCAGG - Intergenic
926020668 2:9492254-9492276 TCCCCACAGATGCAAGTGAATGG + Intronic
927873589 2:26639940-26639962 CCCCCACAGCCCCACGAGAAGGG + Intronic
928173158 2:29016371-29016393 TGCCAGCTGCTGCACGGGAAGGG - Intronic
930017668 2:46982018-46982040 TCCCCACAACCGCAAGGGCAGGG - Intronic
930066144 2:47329167-47329189 TGTCCACATCTGCAGGGGAAGGG - Intergenic
933724842 2:85420865-85420887 TCCCCACAGTGGCCCGGGACGGG + Intronic
934970690 2:98761716-98761738 TGTGCACAGCTGCCCGGGAAAGG - Intergenic
935757128 2:106284874-106284896 TCCTAACAGCTGGTCGGGAAAGG + Intergenic
936444136 2:112583108-112583130 TGCCCACAGGTGCACAGGGAGGG - Intergenic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
942399042 2:175581529-175581551 TCCCCAGAGCTGTACTGGAAAGG + Intergenic
944316011 2:198286493-198286515 TCCCCACTGCTGTCCGGCAAGGG - Intronic
948060768 2:235042054-235042076 TCCCCACAGCTGCAGTTGAGCGG - Exonic
949023515 2:241754253-241754275 TCGTCACAGCCGCACGGGCACGG - Intronic
1169062625 20:2672666-2672688 GCCCCACAGCTGCACTCAAAAGG + Intergenic
1169190667 20:3657399-3657421 CCCCCACACCTGCGTGGGAATGG - Intergenic
1169207125 20:3746860-3746882 TGCCCTCAGCTGAATGGGAATGG - Intronic
1169466599 20:5846708-5846730 TCCCCACACGTGGACGGGATCGG + Intronic
1169941804 20:10945775-10945797 TCCTCACAGCTGCAAGAGATAGG + Intergenic
1170795521 20:19543588-19543610 TCCCCACAGCAGCAGAGGGAGGG + Intronic
1171168998 20:22998867-22998889 TTCCCACGGCTTCTCGGGAATGG - Intergenic
1173577222 20:44120294-44120316 GCCCCACAGTTGCACGTGACAGG + Intronic
1173683568 20:44906368-44906390 TGTCCACAGCTGCAAGAGAAAGG - Exonic
1174644519 20:52073984-52074006 TACCCACAGCTAGACGGCAAAGG + Intronic
1179388978 21:40970101-40970123 TCTCCACAGTTGCATGGGAGGGG + Intergenic
1179886594 21:44316826-44316848 TCCCTATACCTGCAGGGGAACGG - Intronic
1181375764 22:22456813-22456835 TCCGCACAGCTGAAAGGGGATGG + Intergenic
1181485269 22:23226868-23226890 TCCCCTCAGTTGCACCTGAAAGG + Intronic
1182618335 22:31603735-31603757 TCCCCACAGGAGGACGGGCAGGG + Exonic
1183081693 22:35460829-35460851 GCCCTACAGCTGCTCGGGGAAGG + Intergenic
1184072910 22:42157160-42157182 TTTCCACAGCTGCAAGGGGACGG + Intergenic
1184200811 22:42968085-42968107 TGCCCACAGTTGCACAGCAATGG + Intronic
949326897 3:2876162-2876184 TCCCCACTGCTGAACAGGAGAGG - Intronic
950427342 3:12931634-12931656 TTCCCACAGGTGGAGGGGAATGG + Intronic
950739651 3:15040192-15040214 TGCCTAAAGCTGCACGAGAAAGG - Intronic
953891511 3:46755053-46755075 TCCCCACAGCCTCACTGGCAGGG + Intronic
955408682 3:58642143-58642165 TCCTCAAAGCTGCAGAGGAACGG + Intronic
956073761 3:65483242-65483264 TGCCCATTGCTGCACGGTAAGGG - Intronic
957044778 3:75365069-75365091 TCCCCAAAGAGGCAAGGGAAGGG - Intergenic
959031933 3:101309304-101309326 TCTCCACAGCAGCATGAGAATGG - Intronic
959295560 3:104530694-104530716 TCCCAACAGCTTCAGGGGAATGG + Intergenic
968460834 4:723977-723999 TCCTCACAGCTGCTGGGGAAGGG - Intronic
969340817 4:6539857-6539879 CCCACACAGCTGCACGGGCTTGG - Intronic
969668696 4:8577171-8577193 TCCCCAGAGCTGCACGCACATGG - Intronic
977545781 4:98374822-98374844 AGCCCACAGCTGTGCGGGAACGG - Intronic
980149989 4:129033670-129033692 TCTCCAGAGCTGCACAGGACTGG - Intronic
981532363 4:145764896-145764918 TCCCAAAACCTTCACGGGAAGGG + Intronic
982099220 4:151952195-151952217 TCCCCACAACTGCAGGGCAAAGG + Intergenic
984923096 4:184783054-184783076 TCCACACAGCTGTCCAGGAAAGG - Intronic
992829662 5:80582046-80582068 TCCCCATAGCTTGATGGGAATGG + Intergenic
997614867 5:135239393-135239415 TCCCCCCAGCCTCATGGGAAGGG + Intronic
999150866 5:149424974-149424996 TCCACAAAGCTCCATGGGAAGGG - Intergenic
1004196964 6:13513923-13513945 TCACCACAGCTGCTGGGCAAAGG + Intergenic
1005483520 6:26277203-26277225 TCCCAACAGCTCCAAGGGAGTGG + Intergenic
1010126814 6:72442132-72442154 TCCCCAGAGCTGCAGGGGGAAGG - Intergenic
1013314472 6:108928159-108928181 TCCCCAGCTCTGCACGGCAATGG + Exonic
1016178080 6:141105544-141105566 TCCCAGCAGCTGAACTGGAATGG + Intergenic
1019359251 7:596291-596313 TCCCCAAAGGTGTACGTGAACGG - Exonic
1019750062 7:2723670-2723692 TCCCCACAGCTTCAGGGCAGAGG + Intronic
1021971399 7:25968867-25968889 TCGCCACAGCTGCATGGCAAAGG + Intergenic
1023378979 7:39586950-39586972 TCCCCACAGCTGCAGGTCATGGG + Intronic
1027133616 7:75609156-75609178 CCCCCAGAGCTGCAGGAGAAGGG - Intronic
1027544814 7:79514058-79514080 TCCACACAGTTGCACAGGAATGG - Intergenic
1029528904 7:101112356-101112378 TCCCCACGGGGGCAAGGGAAGGG - Intergenic
1032083504 7:128871562-128871584 CCTCCACAGCTGCAGGGGAGCGG - Intronic
1033113696 7:138606450-138606472 TACCCACAGCTGCACAGATAAGG - Intronic
1034193303 7:149227032-149227054 TCCCCAGAGCTGATCGGGGATGG + Intergenic
1037884370 8:22588697-22588719 TCCCCAAAGCTCCACGGGGCAGG + Intronic
1039790818 8:40874270-40874292 TCTCCACAGCTGGACGTGACGGG - Intronic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1042767308 8:72337621-72337643 TCCCCGCAGCTGCATGAGGAGGG - Intergenic
1052142584 9:25004755-25004777 TCCCAACAGCTTCAGGGAAATGG - Intergenic
1053014628 9:34654814-34654836 TCCCAACAGCTGGACTGGAGGGG + Intronic
1054823575 9:69548219-69548241 AGCCCACAGCTGCATGGAAATGG + Intronic
1060266131 9:122112384-122112406 TACCCACAGCTGCCCTGGGAGGG + Intergenic
1060608644 9:124940885-124940907 TCCCCACAGCGGCCCGGTCAGGG - Intronic
1061574515 9:131497665-131497687 ACCCCAGAGCTGCCTGGGAAAGG + Exonic
1185870635 X:3662226-3662248 TCCCCACAGCTGAAGGCCAAAGG + Intronic
1190160640 X:48029170-48029192 ACCCCACACCAGCAGGGGAAGGG - Intronic
1192539846 X:71958504-71958526 TCCCCACTGCTGCTCAGCAATGG - Intergenic
1197394030 X:125903716-125903738 TCTGCACAGATGCACAGGAAGGG + Intergenic
1197404352 X:126030565-126030587 TCCCAACAGCTCCAGGAGAATGG - Intergenic
1200793397 Y:7318904-7318926 TCCCCACAGCTGAAGGCCAAAGG - Intergenic