ID: 1121743602

View in Genome Browser
Species Human (GRCh38)
Location 14:96270633-96270655
Sequence CCTACTTTTCAGGAGCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121743596_1121743602 14 Left 1121743596 14:96270596-96270618 CCAGGATTGTGTTTAAGGCAGTA No data
Right 1121743602 14:96270633-96270655 CCTACTTTTCAGGAGCTTCAGGG No data
1121743594_1121743602 21 Left 1121743594 14:96270589-96270611 CCTATGGCCAGGATTGTGTTTAA No data
Right 1121743602 14:96270633-96270655 CCTACTTTTCAGGAGCTTCAGGG No data
1121743593_1121743602 22 Left 1121743593 14:96270588-96270610 CCCTATGGCCAGGATTGTGTTTA No data
Right 1121743602 14:96270633-96270655 CCTACTTTTCAGGAGCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121743602 Original CRISPR CCTACTTTTCAGGAGCTTCA GGG Intergenic
No off target data available for this crispr