ID: 1121744384

View in Genome Browser
Species Human (GRCh38)
Location 14:96276788-96276810
Sequence CGGGGTGGCCTCGGGGTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121744384_1121744395 -2 Left 1121744384 14:96276788-96276810 CCACCTACCCCGAGGCCACCCCG 0: 1
1: 0
2: 4
3: 28
4: 309
Right 1121744395 14:96276809-96276831 CGGATCTGCGTTTAATGCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 38
1121744384_1121744394 -3 Left 1121744384 14:96276788-96276810 CCACCTACCCCGAGGCCACCCCG 0: 1
1: 0
2: 4
3: 28
4: 309
Right 1121744394 14:96276808-96276830 CCGGATCTGCGTTTAATGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121744384 Original CRISPR CGGGGTGGCCTCGGGGTAGG TGG (reversed) Intergenic
900087200 1:904310-904332 GGGGGCGGCATCGGGGCAGGTGG + Intergenic
900335149 1:2159115-2159137 CGGGGTGAGCTCCGGGTTGGGGG + Intronic
900388146 1:2419966-2419988 AGGGGTTGCCTGGGGGTGGGGGG - Intergenic
901197797 1:7449944-7449966 CCAGGTGGCTTGGGGGTAGGAGG + Intronic
901822998 1:11842205-11842227 CGGGGCAGCCTCAGGGCAGGCGG - Exonic
902373767 1:16020611-16020633 CGGGGTGGCCAAGGTGAAGGTGG + Intronic
903181768 1:21608490-21608512 TGGAGTGGCCTGGGGGAAGGCGG - Intronic
903297141 1:22350951-22350973 CGGGGTGGGGGCGGGGGAGGGGG - Intergenic
903813150 1:26045985-26046007 CGCGGGGCCCTCGGGGCAGGTGG - Exonic
903858160 1:26349403-26349425 AGCTGTGGCCTGGGGGTAGGAGG - Intronic
904532302 1:31177128-31177150 CGGGGTGGCCGCCGGGCAGAGGG - Intergenic
904760924 1:32804267-32804289 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
904832226 1:33312462-33312484 GGGGGTGCCCTTGGAGTAGGAGG + Intronic
905315599 1:37080571-37080593 CGGGGCGGCTTCGGGGCAGAGGG - Intergenic
905389910 1:37629693-37629715 AGGGGTGGTCTCGGGGAGGGTGG + Exonic
905408401 1:37752838-37752860 CGCGGTGGCCTCGGGGTGGGGGG + Intronic
905485626 1:38293753-38293775 CATGGTGGCCTCAGGGTAGCTGG + Intergenic
906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
906678021 1:47707740-47707762 CTGGGTGGTCTAGGGGCAGGAGG + Intergenic
907011466 1:50968081-50968103 AGGGGTGGCCGCGGGGGTGGAGG - Exonic
908845966 1:68324497-68324519 CATAGTGGCCTCGGGGTAGTTGG + Intergenic
912633628 1:111270886-111270908 CCGGGTGGCCTAGGGTAAGGCGG + Intergenic
914869298 1:151459373-151459395 CGGGGGGGCCCCGAGGGAGGGGG + Exonic
915684501 1:157617712-157617734 GGGGGTGGGCTGGGGGTGGGTGG + Intergenic
915897857 1:159825366-159825388 GGGGGTGGGCTCTGGGCAGGAGG - Intergenic
916037437 1:160933620-160933642 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
916671958 1:167029765-167029787 CGGGGTGGCTGCCGGGTAGAGGG - Intergenic
918114332 1:181483831-181483853 CGTGCCGGCCTCGGGGCAGGCGG + Exonic
918697416 1:187560888-187560910 GGGGGTGGGGTAGGGGTAGGGGG + Intergenic
920284332 1:204868779-204868801 CTGGGTGGCCTGGGGGTTGGAGG - Intronic
920804473 1:209219758-209219780 GGGGGTGGCGTGGGGGTGGGAGG + Intergenic
920845854 1:209592507-209592529 TGGGGAGGCCTCGAGGGAGGAGG - Intronic
921185350 1:212665450-212665472 CGGGGCAGCCTCGGGGAGGGTGG - Intergenic
923539234 1:234876244-234876266 TGTGGTGGCCTCTGGGGAGGTGG - Intergenic
924648506 1:245902321-245902343 AGGGGTGGCATCGCTGTAGGTGG - Intronic
1063351688 10:5362548-5362570 CGAGGTGGCCTCAGGGTAGGAGG + Intergenic
1063623234 10:7667299-7667321 CGGGCTGGGACCGGGGTAGGCGG - Intergenic
1063662283 10:8043148-8043170 CGGGGTGGCCCGGGGGACGGAGG + Intergenic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1066107358 10:32167563-32167585 CTGGTTGGCCTGGGGGCAGGAGG - Intergenic
1069823900 10:71243656-71243678 TGGGGTGGCCTCTGAGGAGGGGG - Intronic
1069911926 10:71765223-71765245 TGGGGTGGCTCTGGGGTAGGAGG - Intronic
1071618175 10:87094977-87094999 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
1073123412 10:101135297-101135319 CGGGCGGGCCTTGGGGCAGGAGG + Intronic
1073176261 10:101559431-101559453 CGGGCCGGCCTCGGGTTAAGTGG - Intergenic
1073578283 10:104642369-104642391 GGGGGTGGGGTGGGGGTAGGGGG - Intronic
1074400931 10:113140800-113140822 AGGTGGGGCCTTGGGGTAGGAGG + Intronic
1074867396 10:117553001-117553023 GGGGGTGGCCTCGGTGTGTGTGG + Intergenic
1075129115 10:119723674-119723696 CTGGGTGGCATCGGGGCAGGAGG + Intergenic
1075157409 10:119989550-119989572 CAGGGTGATCTCTGGGTAGGTGG + Intergenic
1075467412 10:122662021-122662043 TGGGGTGTCCTCGGTGTGGGGGG + Intergenic
1076143155 10:128095719-128095741 GGGGGTGGCAGCGGGGGAGGGGG + Intergenic
1076494036 10:130885236-130885258 TGGGGGGGCCTCTGGGGAGGAGG + Intergenic
1076785074 10:132745639-132745661 CGTGGTGGCCTCGGGTGTGGTGG + Intronic
1076785125 10:132745793-132745815 CGTGGTGGCCTCGGGTGTGGTGG + Intronic
1076879012 10:133230955-133230977 CGGGGTGGCGTCTGGGAACGCGG - Exonic
1077009711 11:374673-374695 CGGGGGGGCCTCAGGGAGGGAGG + Intronic
1077514712 11:2994493-2994515 GGGGGTGGCATCCGGGTGGGTGG + Intergenic
1079476900 11:20840602-20840624 CAAGGTGGCCTCAGGGTAGTTGG + Intronic
1081705635 11:45180798-45180820 CGGGGCGGCCACGGGGCAGGGGG + Intronic
1083592797 11:63905100-63905122 CGGGGTGGGTTGGGGGTTGGGGG + Intronic
1083634121 11:64110942-64110964 CGGGCTGGCCTTGGGGAGGGGGG + Intronic
1083726533 11:64631279-64631301 CGTGGGGGTTTCGGGGTAGGGGG + Intronic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1084500004 11:69529807-69529829 GGAGGAGGCCTCGGGGGAGGGGG + Intergenic
1085044002 11:73343090-73343112 CGGGGTGGCGGCGGGGCGGGGGG - Intronic
1085396476 11:76209420-76209442 CCGTGGGGCGTCGGGGTAGGGGG - Intronic
1088810199 11:113387140-113387162 CGGGGTGGCCACGGGGGAGGTGG - Intergenic
1090064108 11:123488672-123488694 TGGGGTGGCAACGGGGGAGGAGG - Intergenic
1091473753 12:752867-752889 CGGGGAGGCCTCGGGGAAGGGGG + Intronic
1091875760 12:3931693-3931715 AGGGGTGGGCTGGGGGTGGGGGG - Intergenic
1093288797 12:17298351-17298373 CTGGGTGGCCTAGGGGTGTGTGG - Intergenic
1093953935 12:25195250-25195272 CGGGGTGGCGTTGGGGGAGGTGG - Exonic
1094325166 12:29230314-29230336 GAGGGAGGCCTCTGGGTAGGGGG + Intronic
1095527663 12:43147103-43147125 CAGGGTGGTCTCAGGGTAGGTGG + Intergenic
1101679435 12:106950754-106950776 AGAGGTTGCCTCGGGGTGGGAGG + Intergenic
1102014306 12:109637666-109637688 CTGGGTGGGCTTGGGGTGGGTGG + Intergenic
1102096414 12:110245001-110245023 GGGCGTGGCCTCTGGGTAGGTGG - Intergenic
1102236812 12:111298774-111298796 CAGGGTGGGCCCAGGGTAGGGGG + Intronic
1103088087 12:118077464-118077486 CTGGGTGGCATGGGGGTAGAAGG - Intronic
1103604865 12:122078978-122079000 CGGGGTGGCCGCGCCGGAGGCGG - Exonic
1103698414 12:122835223-122835245 CGGGGTCGCCGCGGGATGGGGGG + Intronic
1103933548 12:124463383-124463405 CGGGGTGGCCTGGGCCCAGGAGG - Intronic
1104876660 12:132039571-132039593 CGGGGTGGTGGCGGGGTTGGGGG - Intronic
1105368468 13:19782323-19782345 CGGGGTGGCCGCGGGGTCGTGGG - Intronic
1105745618 13:23375111-23375133 CGCGGCGGCCGCGAGGTAGGCGG - Exonic
1107359295 13:39602500-39602522 GGGGGTGGCCTGCGGGCAGGGGG + Intronic
1111388639 13:87561889-87561911 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
1112466096 13:99646320-99646342 TGGGGTGGCCTGGGGGAAGAAGG + Intronic
1113846425 13:113394176-113394198 CGAGGCGGGCGCGGGGTAGGCGG + Intergenic
1113911358 13:113842950-113842972 GGGGGAGGCCCCGGGGCAGGTGG - Intronic
1118270533 14:64338686-64338708 CGGGGCGGCCTCGCGGGGGGTGG - Intergenic
1118600810 14:67470463-67470485 CTGGGTGGCCTCAGGGTGGAAGG + Exonic
1119835826 14:77747878-77747900 CGGGGTGGCCTCTGGGCAGAGGG - Intronic
1120539252 14:85734226-85734248 CGGGGGGGCGGGGGGGTAGGTGG + Intergenic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1120828931 14:88981027-88981049 CGTGGTGGGGTCGGGGGAGGGGG - Intergenic
1121744384 14:96276788-96276810 CGGGGTGGCCTCGGGGTAGGTGG - Intergenic
1122978955 14:105182467-105182489 CATGGTGGTCTCGGGGTAGTTGG + Intergenic
1123992699 15:25695260-25695282 GAGGGTGGCCTCTGGGCAGGCGG - Intronic
1124904741 15:33857943-33857965 CGGGGTGGCCCCGCAGTGGGTGG - Intronic
1125874716 15:43133823-43133845 CAGGGTGGTCGCGGGGTTGGCGG + Exonic
1126343250 15:47666898-47666920 CATGGTGGCCTCAGGGTAGTTGG - Intronic
1128780009 15:70353087-70353109 CGGGGAGGGCTCGGGGTTGCAGG - Intergenic
1128781227 15:70359971-70359993 GGGGGTGGCATGGGGGTGGGAGG - Intergenic
1129248210 15:74292855-74292877 GGGGGTGGGCTCGGGGAAGGAGG - Intronic
1129737610 15:77974890-77974912 CTGGGTGGCCTTAGGGCAGGTGG - Intergenic
1129743331 15:78000882-78000904 GGTGGTGGCCTGGAGGTAGGTGG - Intronic
1129848463 15:78778729-78778751 CTGGGTGGCCTCAGGGCAGGTGG + Intronic
1130253459 15:82315218-82315240 CTGGGTGGACTCAGGGTAGGTGG - Intergenic
1131157550 15:90084499-90084521 CTCGGTGGCCTCATGGTAGGGGG - Intronic
1132152639 15:99473501-99473523 TGGGGTGGCCTTGGGGCAGATGG + Intergenic
1132583125 16:694329-694351 GGGGGTGGCCCCGGGGCAGTTGG + Exonic
1132652473 16:1027902-1027924 CGGCATGCCCTCGGGGGAGGAGG + Intergenic
1132827542 16:1912626-1912648 CGGGCGGGCCTCGGGGTACTTGG - Intronic
1136188999 16:28604386-28604408 CGGCGTGGCCCAGAGGTAGGTGG + Intergenic
1136395985 16:29992777-29992799 CAGAGGGGCCACGGGGTAGGCGG + Exonic
1136419468 16:30122996-30123018 GGGGGTGCCCTCAGGGGAGGGGG - Intronic
1137438978 16:48482964-48482986 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1139574741 16:67833765-67833787 CGGGGTCGCCGCGGGGTGCGCGG + Exonic
1139664459 16:68446889-68446911 CTGGCTGGCCTTAGGGTAGGGGG + Intronic
1139724640 16:68887279-68887301 TGGGGTGGCCACTGGGTGGGTGG - Intronic
1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG + Intronic
1141838649 16:86559912-86559934 GGGGGAGGCCTCGGAGGAGGGGG + Intergenic
1142005976 16:87689802-87689824 CGGGGTGGCCGCGGGGCTGGTGG - Exonic
1143586261 17:7852123-7852145 CGGGGTGGCCACAGGTCAGGTGG - Intronic
1144836008 17:18157077-18157099 TGGGGTGGGCTGGGGGCAGGAGG + Intronic
1144839162 17:18175019-18175041 GGAGGTGGCCTCTGGGAAGGAGG - Intronic
1147186396 17:38715634-38715656 CGTGCTGGCCTCGTGGTGGGAGG - Exonic
1147909577 17:43847384-43847406 CGGGGCGGGCTGGGGGTGGGGGG + Intronic
1148005396 17:44423756-44423778 TGGGGTGGCGGCGGGGGAGGGGG + Intronic
1148776076 17:50096314-50096336 GGGGGTGGCCCTGGGGCAGGAGG + Intronic
1152236811 17:79143230-79143252 CGGGGTGGACTCGGGCGAGCTGG - Intronic
1152558733 17:81067386-81067408 CGGGGGGGCCTCATGGTGGGCGG + Intronic
1152601248 17:81263346-81263368 TGGGGACGCCTTGGGGTAGGAGG - Intronic
1152623504 17:81377904-81377926 CAGGCTGGCCTCGTGGCAGGAGG + Intergenic
1152815501 17:82405267-82405289 CGGGGTGGCCTGGGGCTGAGGGG - Intronic
1153642339 18:7167803-7167825 GGGGGTGGTCCCGGGGTGGGGGG - Intergenic
1156149622 18:34225433-34225455 CGGGGTGGCCTCTGGAGAAGGGG - Intergenic
1158451214 18:57567145-57567167 CGAGGTGGCCTGGGGGTTCGGGG - Intronic
1160453518 18:78980373-78980395 CGGGGTGGCCGGGGGGTCTGGGG + Intronic
1160509304 18:79444424-79444446 CAGCGTGGGCTCGGGGTGGGTGG - Intronic
1160509321 18:79444472-79444494 CAGCGAGGGCTCGGGGTAGGCGG - Intronic
1160766026 19:808462-808484 CGGGGCGGCCCCGGGGTGGAGGG + Intronic
1160900681 19:1426575-1426597 AGGGCTGGCCTGGGGGTTGGGGG - Intronic
1160905564 19:1450226-1450248 CGGGGTGGCCTCGGAGCGCGCGG - Intronic
1160906807 19:1455514-1455536 CGGGGTGGCGCGGCGGTAGGCGG + Intronic
1161417736 19:4157119-4157141 AGGGGTGTCCTGGGGGTCGGAGG - Exonic
1161583042 19:5091155-5091177 CGGGCTGGCCCCGAGGTGGGTGG + Intronic
1161706919 19:5826547-5826569 CTGGGTGGCCCTGGGGAAGGAGG - Intronic
1161815778 19:6498999-6499021 CTGGGTGGCCAGGGGGTGGGAGG + Intronic
1161979966 19:7625137-7625159 GGGGATGGCCTGGGGGCAGGTGG - Intronic
1162315681 19:9936684-9936706 CGGAATGGCCTGGGGGTTGGGGG - Intergenic
1164643638 19:29843523-29843545 CAGGGTGGCCCCGGAGGAGGGGG + Intergenic
1164713730 19:30376835-30376857 GGGGGTGGGGTCGGGGCAGGGGG - Intronic
1165079284 19:33298442-33298464 GGAGGAGGACTCGGGGTAGGAGG + Intergenic
1165305554 19:35000629-35000651 CGGGGTGGGGGCGGGGCAGGGGG + Intronic
1165413670 19:35677919-35677941 CTGGGTGGGCTGGGGGTGGGGGG + Intronic
1165595291 19:37007709-37007731 CGCGGCGGCCTCGGGGTTGGGGG - Intergenic
1165729558 19:38136007-38136029 CCTTGTGGCCTGGGGGTAGGAGG - Intronic
1165735756 19:38174395-38174417 CTGGGGGCCCTCGGGGTATGTGG + Intronic
1166223134 19:41378267-41378289 AGGGGTTTCCTAGGGGTAGGGGG - Exonic
1166568918 19:43781051-43781073 AGGGGAGGCCCCAGGGTAGGGGG + Exonic
1167294955 19:48644572-48644594 GGGGGTGGGGTCGGAGTAGGAGG + Intronic
1167349089 19:48963783-48963805 AGGGGGGACCTTGGGGTAGGGGG + Intergenic
1167606302 19:50482574-50482596 CTGCATGGGCTCGGGGTAGGGGG - Exonic
1168224814 19:54987130-54987152 CGGGGTGGGGTGGGGGTGGGGGG - Intronic
1168340836 19:55622185-55622207 CGGGGTGGCCCCGGAGAGGGCGG - Exonic
1168414251 19:56158762-56158784 TGGGTGGGCCTCGGGGTTGGAGG + Intronic
926093646 2:10066271-10066293 CGGGGTGCCCTCGTGCTAGGTGG - Intronic
926093662 2:10066326-10066348 CGGGGTGCCCTCGTGCTAGGTGG - Intronic
926093676 2:10066381-10066403 CGGGGTGTCCTCGTGCTAGGTGG - Intronic
926159109 2:10475452-10475474 AGGGCTGGCCACGGGGGAGGGGG + Intergenic
927125942 2:20012530-20012552 CGGGCGGGCCACGGGGTCGGGGG + Exonic
927900620 2:26815760-26815782 CGGGGGGGCCGCCGGGTGGGGGG + Intergenic
929689344 2:44061591-44061613 CAGGGTGGCCTCTGGGCAGAGGG + Intergenic
930899140 2:56482353-56482375 CAGGGTGGTCAAGGGGTAGGTGG - Intergenic
931681018 2:64750325-64750347 CGGGGTGGCAGCGAGGGAGGGGG + Intronic
932496615 2:72148696-72148718 CGGGGTGGGGTTGGGGGAGGAGG + Intergenic
934966672 2:98730546-98730568 CGCGGGGGCCGCGGGGCAGGTGG - Intronic
937282649 2:120730875-120730897 CGGGGTGGGCACGGGGGGGGGGG + Intergenic
938152415 2:128899148-128899170 CGGGGGAGACTCGGGTTAGGGGG - Intergenic
938381050 2:130836875-130836897 CGGGGTGGCGTCGGTGGAGCCGG + Intergenic
943060503 2:183037957-183037979 CGGGGAGGCCGCGGCGGAGGCGG - Intronic
945990484 2:216391944-216391966 CTGGGAGGCCTTGGGATAGGTGG + Intergenic
948303946 2:236932729-236932751 CAGAGTAGCCTCGGGGTAGAGGG + Intergenic
948396445 2:237648705-237648727 CGGGCTGGGCTGGGGGTGGGTGG - Intronic
948916343 2:241036568-241036590 TGGCGTGGCCTCTGGGGAGGTGG - Intronic
1168961712 20:1874563-1874585 CGGCCTGGCCTTGGGGGAGGGGG + Intergenic
1169141093 20:3227970-3227992 GTGGGTGGGCTGGGGGTAGGCGG - Intronic
1172387389 20:34543743-34543765 CAGGGTGGCCTCTGGGGAGTGGG - Intergenic
1172603272 20:36198004-36198026 AGGGGTGCCCTTGGGGGAGGGGG - Exonic
1173603224 20:44310801-44310823 CTGGGAGGCCCCGGGGTAGCTGG - Intronic
1173689086 20:44945528-44945550 CGTGGTGGCCTCAGAGTAGTTGG - Intronic
1175740985 20:61419660-61419682 CGGGGTGGCCTTGGCTTTGGGGG - Intronic
1176077084 20:63253638-63253660 CCCGGTGCCCTCGGGGGAGGGGG - Intronic
1176131607 20:63498884-63498906 CGGGCTGGGCCCGGGGTGGGGGG - Intronic
1176875650 21:14124405-14124427 CGGGGCGGGGTCGGGGGAGGTGG - Intronic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1178873097 21:36392452-36392474 CGGGGTGGCGGCCGGGTAGAGGG + Intronic
1178924068 21:36760746-36760768 TGGTGTGGCCTGGGGGTGGGGGG + Intronic
1179801362 21:43812946-43812968 GGGGGGAGCCTCGGGGAAGGGGG - Intergenic
1179905020 21:44418330-44418352 CGGGGGGGCCCCGTGGGAGGGGG - Intronic
1179909599 21:44440957-44440979 GGGCGTGGCCTCCGGGGAGGGGG + Intronic
1180009647 21:45040865-45040887 CGGGCTGACCTCGGGGTGGGAGG + Intergenic
1180090343 21:45531005-45531027 CTGGGGGGCCACGGGGCAGGGGG + Intronic
1180981305 22:19879401-19879423 CGGGGTGGCCTGGAGGGATGCGG - Intronic
1182739439 22:32556725-32556747 TGGGGTGGGCTGGGGGGAGGAGG + Intronic
1183313867 22:37126767-37126789 CGTGGAGGGGTCGGGGTAGGGGG + Exonic
1183482873 22:38074681-38074703 CGGGGAGGCCCCGGGCTGGGCGG + Intronic
1183744678 22:39685747-39685769 CCCGGTGGCCTGGGGGGAGGTGG - Exonic
1184331678 22:43831770-43831792 CGCGGTGGCCTCTGGGAAGCAGG + Intronic
1184512412 22:44941439-44941461 TGAAGTGGCCTCGGGGGAGGAGG - Intronic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
950883399 3:16342207-16342229 CGTGGTTGCCTCGGGGTGGGTGG - Intronic
951686464 3:25350025-25350047 CAGGTTGGTCTCGGGGTAGTAGG + Intronic
952892679 3:38053661-38053683 CGGGGTGGCCGCTGGGCAGAGGG - Intronic
953561387 3:43995841-43995863 AGGTGTGGCCGCGGGGGAGGGGG + Intergenic
953791331 3:45950231-45950253 TGGTGTGGCCTCAGGGTTGGAGG + Intronic
953932000 3:47010107-47010129 CGCTGTGGTCTCGGGGTTGGGGG + Intergenic
953969082 3:47333102-47333124 GGGTGTGGCCTCTGGGTGGGAGG + Intronic
955007557 3:54983732-54983754 CGTGGTGGCCTGGAGCTAGGCGG + Intronic
959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG + Intergenic
960971185 3:123141325-123141347 CTGGGTGGCCTCCAGGGAGGTGG - Intronic
961301568 3:125925263-125925285 CAGGGTGGGCTCGGGGCTGGGGG + Intergenic
961664859 3:128488717-128488739 CGAGGTGGCCTCTGGTGAGGGGG + Intronic
961665780 3:128492555-128492577 CGCGGTGGCCTGGGGATTGGGGG + Intronic
964414091 3:156429382-156429404 AGGGCTGGCCTCAGGGCAGGTGG + Intronic
964812700 3:160682995-160683017 GGTGGTGGCCTCGTGGTAGTGGG - Intergenic
967811795 3:193766858-193766880 AGGGAAGGCCTCGGGGTTGGGGG - Intergenic
968516317 4:1017117-1017139 CTGAGTGGCCTGGGGGAAGGGGG - Intronic
968579634 4:1383962-1383984 CGGGGGGGCCACGCGGTGGGAGG - Intronic
968955908 4:3719345-3719367 CTGGGTGGGTTCGGGGTTGGGGG - Intergenic
968997961 4:3956861-3956883 CGGGGTGGGCTTGGGGGTGGTGG + Intergenic
969346222 4:6571820-6571842 CATGGTGGCCTCAGGGTAGTTGG + Intergenic
969532414 4:7737238-7737260 CGGGGTGGCCTGTGGGAGGGCGG - Intronic
971794151 4:31204609-31204631 CGGGGCGGGCCAGGGGTAGGGGG - Intergenic
974502639 4:62727092-62727114 TGTGGTGGGGTCGGGGTAGGGGG - Intergenic
975862729 4:78694571-78694593 GGGCTTGGCCTCAGGGTAGGAGG + Intergenic
981580291 4:146243570-146243592 CGTGGGGGTCTCGGGGTAGCAGG + Intergenic
982770199 4:159390268-159390290 GGGGGTGGCCACGGGGTGGGGGG - Intergenic
984379244 4:178969213-178969235 CGGGTAGGCCTAGGGGAAGGAGG + Intergenic
985695405 5:1337420-1337442 CGGGGTGGCCCCTGGCAAGGCGG - Intronic
985767506 5:1787660-1787682 CGGGGTGGGCTCTAGGGAGGGGG - Intergenic
985865331 5:2509779-2509801 ATGGGTGGCCTCGGAGCAGGTGG - Intergenic
986330847 5:6714709-6714731 CGGGGAGGCCGCGGGGGCGGGGG + Intronic
987034167 5:14003800-14003822 CAGGGTGGCCTCAGGGCAGTGGG - Intergenic
989835017 5:45977631-45977653 TGGGGTGGGGTCGGGGGAGGGGG - Intergenic
990314954 5:54575195-54575217 CGTGGTGGCTTTGGGGTAGCTGG - Intergenic
990977633 5:61573296-61573318 CAGGCTGGCCTCAGGGAAGGGGG - Intergenic
991342242 5:65624337-65624359 CGCAGAGGCCTCTGGGTAGGTGG - Exonic
997530524 5:134578868-134578890 CGTGGTGGCTTCCTGGTAGGTGG - Exonic
997582095 5:135024497-135024519 GGGGGTGGCCTCAGGGTTGGGGG + Intergenic
1000814989 5:165909696-165909718 GGGGGTGGGCTGGGGGCAGGGGG - Intergenic
1001443343 5:171763097-171763119 CCGGGTGGGCACGGGGTGGGTGG + Intergenic
1002055971 5:176598064-176598086 CCCGGTGCCCTCGGGGAAGGTGG - Exonic
1002081623 5:176740861-176740883 CTGGGGGGCCCCGGGGAAGGCGG + Intergenic
1002175185 5:177397629-177397651 CGGGGTGATCTCGGGGCAGGGGG + Intronic
1003086256 6:3063779-3063801 CGGGGCGGACTGGGGGTAGACGG + Intergenic
1003872250 6:10412527-10412549 GGGGGAGGCCGCGGGGGAGGGGG + Intronic
1003973401 6:11320928-11320950 AGGGGTGGGGTGGGGGTAGGTGG + Intronic
1005992888 6:30914357-30914379 CGGGGCGGCCTCCGGGAAGTGGG + Exonic
1006143663 6:31945703-31945725 AGGGCTGGCCTTGGGGGAGGGGG + Exonic
1006645457 6:35511984-35512006 GGGGGTGGCGTTGGGGTAGAAGG - Intronic
1007048837 6:38804910-38804932 GGGGGTGGCCGGGGGGGAGGGGG + Intronic
1007223535 6:40296991-40297013 CGGGGTGGGCTGGGGGTGGGGGG + Intergenic
1007927676 6:45663346-45663368 CGGGGCGGCCTCCGGGGAGGAGG - Intronic
1012550009 6:100457397-100457419 CGCAGTGGCCTCGGCCTAGGAGG - Intronic
1013073789 6:106752519-106752541 CGGGGTGGCGGGGGGGTAGTGGG + Intergenic
1013530694 6:111017210-111017232 CGGGGTGGCGGCCGGGTAGAGGG + Intronic
1015773550 6:136792310-136792332 CGGCGTGCCCTCGGGGGAGAGGG - Exonic
1018795687 6:167183908-167183930 CTGGCTGGCCTCGGGGAAGGTGG - Intronic
1018820630 6:167371155-167371177 CTGGCTGGCCTCGGGGAAGGTGG + Intronic
1018864431 6:167735787-167735809 GGGGGTGGCCTCAGGGTTGCAGG - Intergenic
1019709248 7:2510847-2510869 CGAGGTGACCTAGGGGTGGGCGG + Intergenic
1019921623 7:4166962-4166984 AGGGAAGGCCTGGGGGTAGGAGG - Intronic
1020080373 7:5283215-5283237 CGGGGTGGCCTCGGGTTCCCGGG - Intronic
1020100426 7:5391240-5391262 GGGGGTGGCCTTTGGGGAGGCGG - Intronic
1020704120 7:11521690-11521712 CGTGGTGGGGTCGGGGGAGGGGG - Intronic
1022241384 7:28515962-28515984 CTGGGAGGCCTCGGGGTGAGAGG + Intronic
1022383818 7:29884179-29884201 GGGGGTGGCGTTGGGGGAGGTGG - Exonic
1025198542 7:56948964-56948986 CGGGGTGGCCTCGGGTTCCCGGG + Intergenic
1025673409 7:63627969-63627991 CGGGGTGGCCTCGGGTTCCCGGG - Intergenic
1026735315 7:72945329-72945351 CGAGGTGGCTGCGGGGCAGGGGG + Intronic
1026785655 7:73300259-73300281 CGAGGTGGCTGCGGGGCAGGGGG + Intergenic
1026837490 7:73648180-73648202 CGGGCTGGGCTCGGGGAGGGAGG + Intergenic
1026930259 7:74219807-74219829 CGGGTTGGGCTCTGGGTTGGGGG + Intronic
1027108411 7:75419677-75419699 CGAGGTGGCTGCGGGGCAGGGGG - Intronic
1028841559 7:95434811-95434833 CGGGGTGGCCGCGTGGTGCGGGG - Intronic
1029126028 7:98295754-98295776 CGGGGTGTGCTTGGGGTGGGTGG - Intronic
1029390838 7:100272652-100272674 GGGGGTGACCTGGGGGGAGGGGG + Intergenic
1029457892 7:100680108-100680130 CAAGCTGGCCTCGGGGTGGGGGG - Exonic
1031852258 7:126879165-126879187 TGGGGTGGGGTCGGGGGAGGGGG + Intronic
1034460543 7:151195683-151195705 CGGGGTGGCCTGGGGCTGGGAGG + Intronic
1035054938 7:156028942-156028964 GGGGGTGGTCTCAGAGTAGGAGG + Intergenic
1035327869 7:158076472-158076494 CAGGTTGGCCCCGGGGGAGGGGG - Intronic
1035735241 8:1882773-1882795 CGGGGAGGACACGGGGTTGGGGG + Intronic
1035735258 8:1882812-1882834 TGGGGAGGACTCGGGGTGGGGGG + Intronic
1036678035 8:10851159-10851181 TGGGCTGGCCCCGGGGTTGGGGG + Intergenic
1038536037 8:28353275-28353297 GGGGCTGGCCTGGGGGTGGGGGG + Exonic
1040500046 8:47997767-47997789 CGGGGAGGACTCAGAGTAGGAGG + Intergenic
1044637586 8:94342041-94342063 CTGGGTGGCCTGGGGGCAGGGGG - Intergenic
1047274575 8:123396099-123396121 CGGAGGGGCCTGGGGGTGGGCGG - Intronic
1048443670 8:134477989-134478011 CTGGGTGGGGTGGGGGTAGGGGG - Exonic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049212175 8:141391896-141391918 AGGGGCGGCCTCGGGGGCGGCGG + Intergenic
1049407622 8:142458663-142458685 CGAGGTGGCCTCAGGGAGGGCGG - Intronic
1049412393 8:142479041-142479063 TGGGGTGGCCGTGGGGTAGTAGG + Intronic
1049762651 8:144338087-144338109 CGGGCGGGCCCCGGGGAAGGCGG + Intergenic
1049788489 8:144462537-144462559 CGGGGCGGCCGCCGGGCAGGCGG - Intronic
1050359441 9:4815515-4815537 TGGGGTGGGGTAGGGGTAGGTGG + Intronic
1050840078 9:10137546-10137568 TGTGGTGGCGTCGGGGGAGGGGG + Intronic
1051239138 9:15033443-15033465 GGTGGTGGCCTCAGGGTAGTTGG - Intergenic
1055577524 9:77674989-77675011 AGGAGTGGCATCGGGGTGGGCGG + Intergenic
1056679153 9:88701927-88701949 GAGGGTGGCCTGGGGGTGGGGGG + Intergenic
1057490449 9:95516212-95516234 GGGGCTGGCCTCGGGGGCGGGGG + Intronic
1058818120 9:108704363-108704385 CAGGGTGGGGTGGGGGTAGGTGG - Intergenic
1059219138 9:112595552-112595574 TGGGGTGGGGTGGGGGTAGGCGG + Intronic
1059368695 9:113807648-113807670 CGGGGTGTGCTGGGGGTTGGGGG - Intergenic
1060087277 9:120714205-120714227 CGGCGGGGCCGCGGGGCAGGTGG - Exonic
1060183838 9:121551971-121551993 CTCGGTGGCCTCTGGGTAGGTGG + Intergenic
1060397270 9:123325021-123325043 CTGGGAGGCCTGGGGGTCGGAGG + Intergenic
1060759711 9:126236962-126236984 CGTGGTAGCCTCGGAGTAGCTGG - Intergenic
1060867946 9:127014676-127014698 CAGGGAGGCCTGGGGGTGGGGGG + Intronic
1060934786 9:127508627-127508649 CTGGCAGGCCTCGGGGTGGGGGG - Intronic
1061306585 9:129736157-129736179 CGGAGGGGCGTGGGGGTAGGGGG - Intergenic
1061542060 9:131282901-131282923 AGGGGCGGCGTCGGGGTGGGCGG - Intergenic
1061953444 9:133949268-133949290 CAGGGCGTCCTCGGGGAAGGAGG - Intronic
1062032126 9:134366505-134366527 CGGGGTGGCTGCTGGGGAGGGGG - Intronic
1062144345 9:134980625-134980647 CTGGGTGGCCGGGGGGCAGGTGG + Intergenic
1062168971 9:135123835-135123857 AGGGGTTGGCTCTGGGTAGGCGG + Intergenic
1062333837 9:136056339-136056361 TGTGGGGGCCTCGGGGTTGGGGG - Intronic
1062513637 9:136921407-136921429 CGGGCAGGGGTCGGGGTAGGGGG + Intronic
1185762976 X:2702315-2702337 GGGGGTGGGGTAGGGGTAGGGGG - Intronic
1187212454 X:17244802-17244824 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1190449923 X:50568825-50568847 CAGGTTGCCCTTGGGGTAGGGGG + Intergenic
1190874402 X:54449366-54449388 GGGGATGGGCTGGGGGTAGGGGG + Intronic
1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG + Intergenic
1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG + Intronic
1194989411 X:100530052-100530074 GGGGGTGGCGTAGGGGTATGGGG - Intergenic
1195870761 X:109482821-109482843 AGTGGTGGCCTGGGGCTAGGAGG - Intergenic
1196765144 X:119236188-119236210 TTAGGTGGCCTCGGGGGAGGCGG + Intergenic