ID: 1121744814

View in Genome Browser
Species Human (GRCh38)
Location 14:96279806-96279828
Sequence GCCAAAGACGTCTCCAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121744814_1121744816 -10 Left 1121744814 14:96279806-96279828 CCATGTCTGGAGACGTCTTTGGC 0: 1
1: 0
2: 1
3: 38
4: 161
Right 1121744816 14:96279819-96279841 CGTCTTTGGCTGTCACAACTGGG 0: 1
1: 1
2: 22
3: 225
4: 732
1121744814_1121744818 -8 Left 1121744814 14:96279806-96279828 CCATGTCTGGAGACGTCTTTGGC 0: 1
1: 0
2: 1
3: 38
4: 161
Right 1121744818 14:96279821-96279843 TCTTTGGCTGTCACAACTGGGGG 0: 1
1: 15
2: 75
3: 304
4: 724
1121744814_1121744824 27 Left 1121744814 14:96279806-96279828 CCATGTCTGGAGACGTCTTTGGC 0: 1
1: 0
2: 1
3: 38
4: 161
Right 1121744824 14:96279856-96279878 TACTGGCATCCAGTGGCCAGAGG 0: 1
1: 5
2: 69
3: 395
4: 1098
1121744814_1121744821 -3 Left 1121744814 14:96279806-96279828 CCATGTCTGGAGACGTCTTTGGC 0: 1
1: 0
2: 1
3: 38
4: 161
Right 1121744821 14:96279826-96279848 GGCTGTCACAACTGGGGGAGGGG No data
1121744814_1121744817 -9 Left 1121744814 14:96279806-96279828 CCATGTCTGGAGACGTCTTTGGC 0: 1
1: 0
2: 1
3: 38
4: 161
Right 1121744817 14:96279820-96279842 GTCTTTGGCTGTCACAACTGGGG 0: 1
1: 0
2: 17
3: 155
4: 637
1121744814_1121744823 20 Left 1121744814 14:96279806-96279828 CCATGTCTGGAGACGTCTTTGGC 0: 1
1: 0
2: 1
3: 38
4: 161
Right 1121744823 14:96279849-96279871 AGTTTGTTACTGGCATCCAGTGG 0: 1
1: 0
2: 8
3: 79
4: 387
1121744814_1121744819 -5 Left 1121744814 14:96279806-96279828 CCATGTCTGGAGACGTCTTTGGC 0: 1
1: 0
2: 1
3: 38
4: 161
Right 1121744819 14:96279824-96279846 TTGGCTGTCACAACTGGGGGAGG 0: 3
1: 12
2: 79
3: 294
4: 592
1121744814_1121744820 -4 Left 1121744814 14:96279806-96279828 CCATGTCTGGAGACGTCTTTGGC 0: 1
1: 0
2: 1
3: 38
4: 161
Right 1121744820 14:96279825-96279847 TGGCTGTCACAACTGGGGGAGGG No data
1121744814_1121744822 10 Left 1121744814 14:96279806-96279828 CCATGTCTGGAGACGTCTTTGGC 0: 1
1: 0
2: 1
3: 38
4: 161
Right 1121744822 14:96279839-96279861 GGGGGAGGGGAGTTTGTTACTGG 0: 1
1: 0
2: 0
3: 26
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121744814 Original CRISPR GCCAAAGACGTCTCCAGACA TGG (reversed) Intergenic
900522791 1:3113707-3113729 ACCAAACACATCCCCAGACATGG + Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
902153614 1:14465042-14465064 GCAAATGACCTCTGCAGACATGG - Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902339829 1:15775716-15775738 TCCAATGACGTCTCCATAGAAGG - Intronic
903248030 1:22030895-22030917 GCCAAAGAGAGATCCAGACATGG - Intergenic
903832706 1:26184216-26184238 GGCAAAGACGTCTTCAGATGGGG - Exonic
904486553 1:30828546-30828568 GCCAAAGAACTCTCTATACATGG + Intergenic
904744758 1:32703598-32703620 GTCAAAGACCTCCCCAGACAGGG - Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
915331608 1:155116320-155116342 GCCCAACACCTCCCCAGACATGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
1063276342 10:4572505-4572527 GCCAAAGAAGTCTCCCTAAAAGG - Intergenic
1069025111 10:63531399-63531421 GCCAAAAATGGCTCCAGATATGG + Intronic
1069417405 10:68213135-68213157 GCCCAAAATGTCTTCAGACATGG + Intergenic
1070959892 10:80491324-80491346 GCCAGAGGGCTCTCCAGACAGGG - Intronic
1071161870 10:82756123-82756145 GCCAAAGTTCTCTCCAGATATGG + Intronic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1076803827 10:132845334-132845356 TCCAGAGATGTCTGCAGACATGG - Intronic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1082770886 11:57206666-57206688 CCCGATGTCGTCTCCAGACACGG + Intergenic
1082922427 11:58510063-58510085 GTCAAAAATGTCTCCAGACGTGG + Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1084064875 11:66698316-66698338 GCCCAAGCCCTTTCCAGACAAGG + Intronic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084471528 11:69362335-69362357 AACAAAGAAGTCTCAAGACATGG - Intronic
1084824420 11:71718776-71718798 GTCAAAGTTGTCTCCAGACCAGG + Intergenic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087290654 11:96316845-96316867 GCCAAAGTGGTGCCCAGACAGGG + Intronic
1089195829 11:116693537-116693559 ACCAAATACTTCTCCAGGCAGGG - Intergenic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1103913458 12:124364145-124364167 CCCAAAGACATCTCCAGGCAAGG + Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1108408852 13:50128141-50128163 GCCAAAGACGTTTTCAGTTAAGG + Intronic
1108641119 13:52383026-52383048 GCCCAAGACATCTCCAGTCTTGG - Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1110174911 13:72544591-72544613 GCCAAAGAAGTTTCTAGTCAAGG - Intergenic
1112316294 13:98364901-98364923 GCTACTGACCTCTCCAGACAAGG - Intronic
1119819498 14:77602413-77602435 GCCAAAGATGACTCCAAACTTGG - Intronic
1121744814 14:96279806-96279828 GCCAAAGACGTCTCCAGACATGG - Intergenic
1126165215 15:45649195-45649217 CCCAAAGACTTGTCCAGACCAGG + Intronic
1129876419 15:78978616-78978638 GCCAATGACCTCCCCAGAGAAGG - Intronic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133605362 16:7381923-7381945 CCCAAAGATGTCTCTAGACTTGG + Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1136656750 16:31713646-31713668 CCCAAAGACGGCTCCGGCCATGG - Intronic
1141407690 16:83808234-83808256 GCCAGAGACGCTTCCAGAAACGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1142109423 16:88323332-88323354 GCCACAGACCTGTCCTGACAGGG + Intergenic
1143334048 17:6159210-6159232 TCTAAAGAGGTCTCCAGACCAGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1147916819 17:43892762-43892784 GCCAAAAACGTTTCCAGAGAAGG + Intronic
1148255794 17:46130727-46130749 GCTAAATACATCTCCAGCCAAGG + Intronic
1150063131 17:62085918-62085940 TCAAAAGAAGTTTCCAGACAAGG + Intergenic
1151102530 17:71572328-71572350 GCCAAAAGTGTCTCCAAACATGG + Intergenic
1151227984 17:72660868-72660890 AACCAAAACGTCTCCAGACATGG + Intronic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158375090 18:56854511-56854533 TCCAAAGAAGTCTCCATAAAAGG - Intronic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161126583 19:2561250-2561272 GCCACAGATGTCCCCAGACATGG - Intronic
1161143856 19:2665326-2665348 GCCACAAATGTCCCCAGACATGG + Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1161572398 19:5037765-5037787 GCCACAGACATCCCCAGACATGG + Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1162421337 19:10567703-10567725 ACCAAAGACGCCCCCAGATATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1164030311 19:21397491-21397513 GCCAGAGAGGACTCCAGGCAGGG - Intronic
1168426834 19:56245839-56245861 CACAAACACATCTCCAGACATGG - Intronic
927417804 2:22897224-22897246 GCCAATGACTTCTCCAAACCAGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
932967572 2:76495285-76495307 GCCAAAGATGTCACCAAAGAAGG + Intergenic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937049999 2:118880853-118880875 GCCAAGGAGGTTTCCAGGCAGGG + Intergenic
937926928 2:127174836-127174858 GCCAGAGAAGTCCCCAGAGAAGG + Intergenic
942454006 2:176125306-176125328 GCCAAACCCCTCTCCAAACAAGG + Intergenic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947847968 2:233260866-233260888 GGCAAAGATTTCCCCAGACAAGG - Intronic
948179003 2:235965508-235965530 GCTGCAGACCTCTCCAGACAAGG - Intronic
948553327 2:238790732-238790754 GCCAAACACATCTACAGACATGG + Intergenic
1168774381 20:435700-435722 TCCAATGACGTCTCCATAAAAGG - Exonic
1171125045 20:22595387-22595409 GCCAAAGACTGCTCCAGAATTGG + Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173114321 20:40225587-40225609 GCCAAAACTGTCTCCACACATGG - Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175548433 20:59797634-59797656 GCCACAGACTTCTGCAGACTAGG - Intronic
1175786271 20:61713597-61713619 GCCAAAGACTCCCCCAGAAAAGG + Intronic
1178374700 21:32057057-32057079 GTCAAAGACGTCTTCAGGCATGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1183240424 22:36653673-36653695 GCCACAGGTGTCTGCAGACATGG + Intronic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183719051 22:39551630-39551652 GCCAAAGAAGGCTCCACAAAGGG - Intergenic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
952833589 3:37585652-37585674 GCTAAAGAAGTCTCAACACAAGG + Intronic
952992121 3:38840293-38840315 GACAAAGACGTATCAAGAAAAGG - Intergenic
953505150 3:43478622-43478644 GCCAAAGACTTCTCCCCACTAGG - Intronic
955378196 3:58415580-58415602 TCCAATGACGTCTCCATAAAAGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
959720718 3:109484791-109484813 GCCAAAGATGAATCCAAACAAGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962331296 3:134481039-134481061 GCCATAAACTTCTCCAGAAATGG + Intronic
963084988 3:141428118-141428140 GCCAGAGAGGTCTCCAAGCAGGG - Intronic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
967896073 3:194397059-194397081 CCCAAACACGTCGCCAGGCAGGG + Exonic
968607038 4:1540399-1540421 GCCAAGGACGTGTCCTGGCAGGG - Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969087273 4:4665839-4665861 GACACAGACATCCCCAGACATGG + Intergenic
969104128 4:4792016-4792038 GCCAAAGCCAGCTCCACACAGGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
983790523 4:171792063-171792085 TCCAATGATGTCTCCAGAAAAGG - Intergenic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
988290843 5:29283743-29283765 GCAAAAGACTTCTCCAATCAAGG - Intergenic
988404355 5:30805032-30805054 ACCAAAGCCCTTTCCAGACACGG - Intergenic
990304657 5:54482386-54482408 GCCCAAGATGTCACCAGCCAAGG + Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
999087217 5:148903626-148903648 CCCCAACAGGTCTCCAGACAAGG - Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1011444589 6:87424057-87424079 GCCCAAGATGTCACCAGAAATGG - Intronic
1012244100 6:96906914-96906936 TCCAGAGAAGTCTCCAGAGAAGG + Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1018080803 6:160258232-160258254 GCCAAAGAGATGTCCAGGCAGGG + Intronic
1018896331 6:168020345-168020367 TACAAAGACATTTCCAGACATGG + Intronic
1019496078 7:1341258-1341280 CCCAAAGAAGTCCCCAGCCATGG - Intergenic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033226542 7:139567504-139567526 CTCAAAGACGCCTCCAGAAATGG - Exonic
1035729982 8:1847077-1847099 GCCAAAGACATTTCTAGAGAAGG - Intronic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1039890554 8:41682825-41682847 GTCAAAGAAGTCTCGACACATGG + Intronic
1042742102 8:72061330-72061352 GCTAAAGAAGTCTACATACACGG - Intronic
1042757808 8:72236606-72236628 GCTAAAGAAGTCTACATACAAGG - Intergenic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1048269377 8:133016402-133016424 GCCAAAAATGTCTCCAGATGTGG + Intronic
1048692584 8:136984186-136984208 GACAAACACGGCTTCAGACAAGG + Intergenic
1049395399 8:142397920-142397942 GCCGAAGAGGTCTGGAGACAGGG - Intronic
1049533087 8:143166151-143166173 ATCAAAGACGTCTGCAGAAATGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1057211963 9:93205377-93205399 GCCAATGGCCTCTCCAGACCTGG - Intronic
1058104615 9:100956019-100956041 GACAAAGTGGTCTCCTGACATGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060322698 9:122579392-122579414 TCCAAAGCAATCTCCAGACAAGG - Intergenic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190889828 X:54558363-54558385 TCCAAAGACTTCTGCAGAAAAGG - Intronic
1190935265 X:54993992-54994014 TCCTAAGATGTCTCCAGAGATGG - Exonic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic