ID: 1121748061

View in Genome Browser
Species Human (GRCh38)
Location 14:96318341-96318363
Sequence CTGAAGAAACTGTCTCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121748058_1121748061 20 Left 1121748058 14:96318298-96318320 CCTGTGGGGTGTCCAGGGCAGAA 0: 1
1: 1
2: 2
3: 30
4: 205
Right 1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG 0: 1
1: 0
2: 1
3: 26
4: 216
1121748054_1121748061 28 Left 1121748054 14:96318290-96318312 CCCTCAGTCCTGTGGGGTGTCCA 0: 1
1: 0
2: 2
3: 19
4: 169
Right 1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG 0: 1
1: 0
2: 1
3: 26
4: 216
1121748059_1121748061 8 Left 1121748059 14:96318310-96318332 CCAGGGCAGAATCATTATTCTCA 0: 1
1: 0
2: 1
3: 24
4: 291
Right 1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG 0: 1
1: 0
2: 1
3: 26
4: 216
1121748055_1121748061 27 Left 1121748055 14:96318291-96318313 CCTCAGTCCTGTGGGGTGTCCAG 0: 1
1: 1
2: 2
3: 10
4: 227
Right 1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG 0: 1
1: 0
2: 1
3: 26
4: 216
1121748053_1121748061 29 Left 1121748053 14:96318289-96318311 CCCCTCAGTCCTGTGGGGTGTCC 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG 0: 1
1: 0
2: 1
3: 26
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121748061 Original CRISPR CTGAAGAAACTGTCTCATAA AGG Intronic
904421124 1:30393939-30393961 CTGAAGAAATTGTATAATATTGG - Intergenic
906674216 1:47681517-47681539 ATGAGGAAACTGGCTCAGAAAGG - Intergenic
909380555 1:74993153-74993175 CAAAAGATACTGTATCATAAAGG - Intergenic
909889153 1:80981219-80981241 ATGAAGAAACTGTATCAAAAAGG + Intergenic
910727288 1:90352345-90352367 CTGAAGAAACTGAGGCTTAAGGG + Intergenic
912310664 1:108617796-108617818 ATGAAGAAACGGCCTCAGAAAGG + Intronic
913300427 1:117364196-117364218 CTGAGGAAAATGCCTCATAGAGG + Intergenic
913445131 1:118943059-118943081 ATGAAGAAATTGGCTCAGAAAGG - Intronic
917135917 1:171787909-171787931 CTGAAGGATGTGTCTCACAAAGG + Exonic
917152819 1:171963067-171963089 CTACAGAAACTGGCACATAAAGG + Intronic
919350111 1:196440651-196440673 CTGGAGTAACTGTTCCATAAAGG + Intronic
919598108 1:199589798-199589820 ATGAAGAAACAGTCTAGTAAAGG - Intergenic
920910593 1:210212881-210212903 CTGAAGAAGCTGCACCATAATGG + Intergenic
920979048 1:210814986-210815008 CTGAAGAGACTGTCTCAAAGAGG + Intronic
923838844 1:237645338-237645360 GAGAAGAAACTGTCTCAAATGGG - Intronic
1063620083 10:7638612-7638634 CTGAAGTAACTTTCTCAGAATGG - Intronic
1063814183 10:9754382-9754404 TTGATGAAAATGTCTCATTAAGG - Intergenic
1065166288 10:22981838-22981860 CTGATGATTCTGTTTCATAAGGG - Intronic
1065602323 10:27382052-27382074 CTGAATTATTTGTCTCATAATGG - Intergenic
1067684628 10:48459060-48459082 ATGAAAAAACTGCCCCATAATGG + Intronic
1068302694 10:55164769-55164791 CTGATGAAACTGAATCAAAATGG + Intronic
1068615221 10:59106979-59107001 GGGAAGAAACTGTGTCAAAATGG - Intergenic
1068696090 10:59969525-59969547 CTGAAGAAGCTATTTGATAAAGG + Intergenic
1070098169 10:73358673-73358695 CTGAAGAAACTCTCTCTTCCCGG - Intronic
1070496646 10:77030329-77030351 CAGAAGTAACAGTCCCATAAAGG - Intronic
1073415481 10:103377936-103377958 CTAAAGAAACTGTCTACCAATGG + Intronic
1076813983 10:132905499-132905521 CTCAAGAAACTTTCTAAAAATGG + Intronic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078437188 11:11335098-11335120 TAGAAGAACCTGTCTCACAAAGG + Intronic
1078512267 11:11994332-11994354 CTGAAGAAACCGAGTCACAAAGG + Intronic
1080307131 11:30848790-30848812 AGGAATAAACTGTATCATAAAGG - Intronic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1084597771 11:70127348-70127370 CTGCAGGAACTGTTCCATAAGGG + Intronic
1085148463 11:74226290-74226312 ATGAGGAAACTGGCTCATATAGG + Intronic
1085720603 11:78909385-78909407 ATGAGGAAACTGACACATAAAGG + Intronic
1086261671 11:84947351-84947373 CTGCAGTAACTGGCTCAAAATGG + Intronic
1086535483 11:87839686-87839708 CTGAAGAAACTCTCTTAATATGG + Intergenic
1086851716 11:91816859-91816881 CTGAAAAAAATGTCTTGTAAAGG - Intergenic
1087498612 11:98921456-98921478 CAGAAGAAAAAATCTCATAATGG + Intergenic
1088200234 11:107324326-107324348 GTAAAGAAAGTGTTTCATAAAGG + Intergenic
1088392162 11:109326492-109326514 ATGAAGAAACAGTCCCAGAAAGG - Intergenic
1089192436 11:116662702-116662724 TTGAAGAAACAGTCTCAGAGAGG - Intergenic
1090158055 11:124462730-124462752 CGGAAGAAACTCTCTCTAAAGGG - Intergenic
1090450317 11:126800424-126800446 CTACAGAAACGGTCTCATTAGGG + Intronic
1090537203 11:127656270-127656292 TTGAAGCAACTGTATCAGAAAGG - Intergenic
1090587056 11:128224278-128224300 CAGAAGAAACTATCTCAGAATGG + Intergenic
1091198020 11:133748275-133748297 CTGAAGAAACTGAGTCTGAAAGG + Intergenic
1091538996 12:1441812-1441834 ATGACGAAACCGTCTCATCACGG - Intronic
1091628886 12:2143521-2143543 CTGTAGCAACTGTCGCACAATGG - Intronic
1092041142 12:5385622-5385644 ATGAATAAACTGTCTCTTAATGG + Intergenic
1093559964 12:20526864-20526886 CAGAAAAAAATGTCTCCTAATGG - Intronic
1094528566 12:31250395-31250417 GTCAAGAAACAGTCTCAGAAAGG - Intergenic
1095704995 12:45227477-45227499 CTGAAGAAACAGGCTCAGAGAGG - Intronic
1097114148 12:56685144-56685166 CTTAAGAATCTGGCTGATAAGGG - Intronic
1097391227 12:59016540-59016562 ATGAAGAAATTGTTTTATAATGG + Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100201343 12:92300940-92300962 GTGAAGAAAGTGTCTCAAGAAGG + Intergenic
1101593355 12:106141414-106141436 TTGAAGAAACCGTATCAGAAAGG + Intergenic
1101684061 12:106999641-106999663 CTGACGAAGCTGTGTCATGATGG + Exonic
1105711350 13:23012210-23012232 TTGAAGAAACTGTGACATGATGG - Intergenic
1106024674 13:25945715-25945737 TTGGAGAAAATGTCTCATCAAGG + Intronic
1107497743 13:40945074-40945096 CAGAAGAATCTGTCTCATGAAGG - Intronic
1107930306 13:45301515-45301537 CTGAAGAAAGTGCCTCTTCATGG + Intergenic
1108013394 13:46046881-46046903 GGGTAGAAACTGCCTCATAAGGG + Intronic
1109034681 13:57241355-57241377 CTGAAGAAACTGTTTCCAGATGG + Intergenic
1110094444 13:71498792-71498814 CTGAAGAAACTGTATTTTTAGGG + Intronic
1110117208 13:71834152-71834174 CTGAAGTAACTTTATCCTAAGGG - Intronic
1115008551 14:28516543-28516565 ATGAAGAAGCTGTTTCATAAAGG - Intergenic
1117550281 14:56828767-56828789 CTGAAAGATCTGACTCATAATGG - Intergenic
1118891746 14:69915776-69915798 CTGAGGAAAGTGTCCCATGATGG - Intronic
1120001131 14:79304197-79304219 CTGAATGAACTGTCCCCTAATGG - Intronic
1120182730 14:81362061-81362083 CTGAGGAACCTTTTTCATAATGG - Intronic
1120337468 14:83175127-83175149 TTGAAGTAACTATTTCATAAAGG + Intergenic
1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG + Intronic
1123585132 15:21753205-21753227 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1123621779 15:22195812-22195834 CTGGAGACACTGTCTCAGGAGGG - Intergenic
1125580851 15:40784532-40784554 ATGAGGAAACTGTGACATAAGGG + Intronic
1126247672 15:46528059-46528081 CTGAAGAAATTGTGCCATACTGG + Intergenic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1127777435 15:62276904-62276926 CTAAAGAAACTGTCTCCTAATGG + Intergenic
1129230496 15:74194534-74194556 ATGGAGAAACGGTCTCAGAAAGG + Intronic
1129908987 15:79210270-79210292 CTGAAGAAAATGTCTGGAAAGGG - Intergenic
1130344327 15:83027837-83027859 CAGCTGAAACTGTCTCATCATGG + Intronic
1130913985 15:88290626-88290648 CTGAAGAAACCTGCTCATGATGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133964444 16:10520095-10520117 AGGAAGACACTGTCTCAGAAAGG - Intergenic
1135665188 16:24329635-24329657 ATGAAGAAAGTGTCACATTAGGG + Intronic
1137857766 16:51813219-51813241 TTGCAGAAAATGTCTGATAATGG - Intergenic
1140135490 16:72201936-72201958 CTGAAGTAACTGTCCCATCCTGG + Intergenic
1140635087 16:76902885-76902907 CTGAAAAAACTGTCACAGATTGG - Intergenic
1141789085 16:86221131-86221153 TTGAGGAAACTGTCTCATTGTGG - Intergenic
1144187398 17:12809491-12809513 CTGAAGAAATTATTTTATAAAGG - Intronic
1144265267 17:13562552-13562574 CTGAAGAAACAGTATCCTGATGG + Intronic
1145724528 17:27105881-27105903 CTGATGAAACTGAATCAAAATGG - Intergenic
1145812038 17:27770116-27770138 CTGGAGAGACAGTCTCATATTGG + Intronic
1145947762 17:28790540-28790562 CTGAAGAAACTGTTCCAGACTGG + Intronic
1146909717 17:36641082-36641104 CTTAAGGAACTGTCTCAAACTGG - Intergenic
1148396543 17:47312607-47312629 ATGAAGAAACTGTATCAAAGGGG + Intronic
1149375902 17:56043696-56043718 CTGAAGAAAGTGTTTCAAAGAGG + Intergenic
1149599063 17:57881672-57881694 CAGTAGAAACTGTCCCCTAAAGG + Intronic
1150845773 17:68656493-68656515 CTGAAGAACCTGTTTCCTGAAGG - Intergenic
1151063652 17:71125832-71125854 CTGTAGAAAATTTCTAATAAGGG - Intergenic
1152771901 17:82175192-82175214 CTGGAGAAACAGTCGCATGAGGG + Intronic
1158681275 18:59569182-59569204 CTATAGCATCTGTCTCATAAGGG + Intronic
1159852120 18:73536539-73536561 GTGAAAACACTGTCTCATCAGGG - Intergenic
1161742758 19:6033897-6033919 CTCAAGATACTGTTTGATAAAGG - Intronic
1163098917 19:15081833-15081855 TGGAAGAAACTGGCTCATTAAGG - Intergenic
1164206094 19:23060031-23060053 CTGATGCAACTGTCTCATATAGG - Intergenic
1164872886 19:31661021-31661043 CTGCAGATGCTGTCTCATCAGGG - Intergenic
1165898188 19:39155832-39155854 CTGAAGGACCTGTCTCATTTAGG + Intronic
1166495634 19:43301286-43301308 CTGAAGACAATGGCTCATAATGG + Intergenic
1167262190 19:48464991-48465013 CTGAGGAATCAGGCTCATAAAGG - Exonic
1167713149 19:51124643-51124665 CTGCAGAAAATGTCACCTAAGGG + Intergenic
926591396 2:14743817-14743839 CTGAAGAAACTGGAACATGATGG - Intergenic
927835519 2:26395236-26395258 ATGAAGAAACTATCTGATAAAGG - Exonic
928836288 2:35550477-35550499 CTATAGAAACTGTGTCATTATGG + Intergenic
930077244 2:47416701-47416723 GTGAAGAAACTATGACATAAAGG - Intronic
931268918 2:60684816-60684838 CTGAAGAAACAGTTTAAAAATGG + Intergenic
933650544 2:84846796-84846818 CTGAAGAAACAGTCTCTGAGTGG + Intronic
935448474 2:103181930-103181952 CTGAAGAGACTGTAAAATAAAGG + Intergenic
935863329 2:107358333-107358355 CTGAGCAAACTGTGTCAAAAAGG - Intergenic
936981627 2:118270204-118270226 ATGAAGAAACTGACTCCTAGAGG + Intergenic
938046076 2:128122016-128122038 TTGAAGAAACTGAGTCATAGAGG + Intronic
938687667 2:133756309-133756331 CTGAAGATCCTGTCTCACAGAGG - Intergenic
940039729 2:149347678-149347700 CTTAAGAAACTATCTCTTATTGG + Intronic
940473585 2:154131510-154131532 ATTAAGAAACTGTCTCTTCATGG + Intronic
940900782 2:159124506-159124528 CTGAAGTAACTGACTCCAAAAGG - Intronic
941153614 2:161947097-161947119 CTGAGGAAACTGAAGCATAAAGG - Intronic
941641384 2:167992412-167992434 CTGAAGAAACTGTCTGGAACTGG + Intronic
941703164 2:168627367-168627389 CTGAAGTAATTTTTTCATAAAGG + Intronic
942643926 2:178090798-178090820 CTGAAGGAATTATCTGATAAGGG - Intronic
942710764 2:178832904-178832926 CTGAATAAAGTGTTTCAGAAAGG + Exonic
943539013 2:189188196-189188218 GTGAAGAAAATGTCATATAATGG - Intergenic
943761323 2:191612628-191612650 TTGAAGAATCTGATTCATAAGGG + Intergenic
943893342 2:193320405-193320427 CTAAAGAAACTGTCACATATTGG + Intergenic
945963073 2:216156333-216156355 CAGAAGAGACTGTTTCAGAAAGG - Intronic
948117101 2:235501504-235501526 CTGAAGGAAGTGACTCATAAGGG + Intronic
948678905 2:239618485-239618507 CTGTAGAAACAGTCTCAAAGGGG - Intergenic
1169099851 20:2937705-2937727 CTAAAGAAACTCTATCAGAAAGG - Intronic
1169511641 20:6270155-6270177 ATGAAGAAACTGAAGCATAAGGG - Intergenic
1170276133 20:14591706-14591728 CTGCAGAACCTGTCTTATAAAGG - Intronic
1170868108 20:20178284-20178306 ATGAAGAAAATGTATCATAAAGG - Intronic
1171084771 20:22227529-22227551 CTCATGAAAATGTCTCATATGGG + Intergenic
1172514505 20:35523587-35523609 CTGAGGAAACTGATTCCTAATGG + Intronic
1172813810 20:37670691-37670713 CTGAAGGAACTGGCTCGTGAGGG + Intergenic
1177161388 21:17551682-17551704 CAAAAAAAACTGTCTCTTAAAGG - Intronic
1178027549 21:28485392-28485414 TTGAAGAAACTTTCTCAGAAAGG + Intergenic
1180020803 21:45125365-45125387 CTGAAGAAGCCTTCTCATACAGG - Intronic
949262557 3:2119384-2119406 CTAGAGAAACTTTCTCATACAGG - Intronic
950879087 3:16307407-16307429 ATGAAGAAAGTGTTTCATAGAGG + Intronic
951417309 3:22440531-22440553 ATGATGAAACTGGATCATAAAGG - Intergenic
952027910 3:29105735-29105757 TTGAAGAAACTGAGGCATAAAGG - Intergenic
952637848 3:35553470-35553492 GTGAGGAAACTGCATCATAAAGG + Intergenic
952868929 3:37880209-37880231 CTGAGGAAACAGTCTCAAAGAGG + Intronic
954352041 3:50052760-50052782 CGGAAGAAACAGTCTCAATATGG + Intronic
954759850 3:52866284-52866306 CTGAAGAGGCTGTCTCAGCACGG + Intronic
955244775 3:57214532-57214554 CAGAAGAAACAGGCTCAAAAAGG - Intronic
955417718 3:58708245-58708267 CTGATGGAACTGTTTCAGAAGGG + Intergenic
956270123 3:67442469-67442491 CTGAAGAATCTGTGTTCTAAAGG + Intronic
960584808 3:119310906-119310928 CTGAAGAAACAGGCTTTTAAAGG + Intronic
963096999 3:141553905-141553927 CTAGAGAAACTGTTGCATAAGGG - Exonic
963129760 3:141847322-141847344 CTGAAGAAAGAGGCTCAAAATGG + Intergenic
964800490 3:160551843-160551865 CTGAAGTAACTGTATTCTAATGG + Intronic
965157772 3:165086953-165086975 CCACTGAAACTGTCTCATAAGGG - Intergenic
965258829 3:166453038-166453060 AAGAAGAAAGTATCTCATAAAGG - Intergenic
965442825 3:168737287-168737309 CTGAGGACACTGTCTCCTCAAGG - Intergenic
965759833 3:172063921-172063943 ATGATGTAACTGTCTCCTAAAGG - Intronic
965875028 3:173306166-173306188 GTGAGGAAACTGTCTCAGAGGGG + Intergenic
966403318 3:179568983-179569005 CTGGAGACACTCTCTCATACAGG - Intronic
966505318 3:180694262-180694284 CTTAAGACACTCACTCATAAAGG - Intronic
967111145 3:186295119-186295141 TTGAAGAAACTCTCTCTTCAAGG + Intronic
967197314 3:187039703-187039725 CTGAAGAAACTTTCTCTAAATGG - Intronic
970461019 4:16275075-16275097 GTGATGCAACTGTGTCATAACGG + Intergenic
971035835 4:22692011-22692033 CTCAAATAACTGTCTGATAAAGG - Intergenic
971761883 4:30776607-30776629 CTGAAGAAACGGTCTCAGGAAGG - Intronic
973855114 4:55003464-55003486 CTGAAGGAGTTGTCTCATGAAGG - Intergenic
974056579 4:56989363-56989385 CAGTAGAGACTGTCACATAATGG - Intronic
974582327 4:63819004-63819026 CTAACAAAACTGTCTAATAAAGG - Intergenic
975518991 4:75277735-75277757 CTGAACAAACTGCTTCAGAATGG + Intergenic
980147034 4:128999600-128999622 CTGAAGAAACTGTTTTAGAGGGG - Intronic
980566916 4:134554333-134554355 CTCAAGAAACTTTGTCTTAAAGG + Intergenic
980697402 4:136377379-136377401 TTCAAGAAACTGTTTCAAAAAGG - Intergenic
981287510 4:143036171-143036193 CTGAAGAAGCTCTCAGATAAGGG + Intergenic
985645902 5:1084672-1084694 CTGAAGGAACAGCCTCATAGAGG - Intronic
986446710 5:7827617-7827639 CTGAAACAACTGTGTCAAAAGGG - Exonic
987480676 5:18453269-18453291 CTGAAGAATATGTTTTATAAAGG - Intergenic
988168354 5:27623738-27623760 CTAAAGAAAATGTATCAAAAAGG + Intergenic
988267093 5:28966295-28966317 GTTAAGAAACTGTTTCACAATGG + Intergenic
993821565 5:92623905-92623927 CTGAAGAAAGTGTTTCAAGAAGG + Intergenic
995163966 5:109015471-109015493 ATCAAGAAGCTGTCACATAATGG - Intronic
996179000 5:120395739-120395761 CTGAAGAAACTCTCTGGTAAAGG - Intergenic
1004444124 6:15682165-15682187 TTGAAGAAACAGGCTCAGAATGG - Intergenic
1007688486 6:43681983-43682005 CTAAAGAAACTGTGTCAACACGG - Intronic
1009572972 6:65413057-65413079 CTGAATAAAAAGTCTGATAATGG + Intronic
1011059430 6:83247721-83247743 ACGGAGAAACTGTGTCATAAGGG + Intronic
1011773415 6:90701004-90701026 CTGCACAAACTGTCTCATTATGG + Intergenic
1012228132 6:96728597-96728619 GTGAAGTATCTGGCTCATAAAGG - Intergenic
1012544141 6:100397162-100397184 CTAATGAAATTGTGTCATAACGG - Intronic
1013262941 6:108464376-108464398 CTGTAGAAATTTTCTCAAAATGG + Intronic
1014916313 6:127153121-127153143 ATGAAGCACATGTCTCATAAAGG - Intronic
1022525791 7:31036347-31036369 ATGAAGAAACAGGCTCAGAAAGG + Intergenic
1023328091 7:39082041-39082063 CTGAGGAGACTGTCTGGTAAAGG + Intronic
1026653026 7:72232137-72232159 CAGAAGAAACTGCCTCAGCAGGG + Intronic
1026772923 7:73213495-73213517 ATGAAGAAAATGTCACATGAAGG - Intergenic
1027013786 7:74766891-74766913 ATGAAGAAAATGTCACATGAAGG - Intergenic
1027074252 7:75179141-75179163 ATGAAGAAAATGTCACATGAAGG + Intergenic
1028359200 7:89947631-89947653 CTGAAGAAATCATCACATAATGG + Intergenic
1028874091 7:95801059-95801081 CTCAAGAGAATGCCTCATAAAGG - Intronic
1031845822 7:126805132-126805154 CTAAAGAAATTGGCTCAGAAAGG + Intronic
1032867621 7:135943036-135943058 TTTAAGAAACTGTGTCATAAAGG - Intronic
1033962945 7:146936244-146936266 CAGAAGAAACTGTATAAAAATGG + Intronic
1037201187 8:16254713-16254735 GTGAAGGAAGTGTCTCAAAAAGG - Intronic
1037730989 8:21523978-21524000 CTGAAGACGCTGTCCCATCATGG + Intergenic
1038885673 8:31659986-31660008 CAGATGAAACTGTCTCAGAGGGG + Intronic
1039597232 8:38801370-38801392 ATGCAGAAACTGACTCAAAATGG - Intronic
1040016505 8:42704761-42704783 CTGAAGACACCATCTCACAATGG - Intronic
1041176662 8:55203781-55203803 CTGCAGAAAATGACTCATAAAGG + Intronic
1041531721 8:58875865-58875887 CTGAAGATACAGTCCCAGAATGG - Intronic
1042256729 8:66812214-66812236 TTTGAGAAACTGTCTCCTAACGG - Intronic
1042966225 8:74356328-74356350 TGGAACAAACTGTCTGATAAAGG + Intronic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1047688578 8:127327194-127327216 CTGAAGAAAATTTCAGATAAAGG - Intergenic
1048928326 8:139290746-139290768 CTGGAGACACTGTCTCAGAAAGG + Intergenic
1050281143 9:4051121-4051143 CTAAAGAAACTGGGTCAAAATGG + Intronic
1050340564 9:4633607-4633629 CTGAAGAAACAGACTACTAAGGG + Intronic
1050466288 9:5927682-5927704 GTAAAGAAAATGTTTCATAAAGG - Intronic
1051510992 9:17877796-17877818 CTGAGGAAACTGTGACATAGAGG + Intergenic
1055418005 9:76105163-76105185 ATGAAGAAAATGTGGCATAATGG + Intronic
1055553710 9:77454632-77454654 CTAAAGAAACAGTCTCAGAATGG - Intronic
1058495627 9:105555963-105555985 CTGAATAAACCTTCTCAAAAAGG - Intergenic
1059384902 9:113956993-113957015 ATGAAGAAACTGAGTCACAAAGG + Intronic
1059757785 9:117309999-117310021 ATGAAGAAACAGGCTCAGAAAGG - Intronic
1060060727 9:120457149-120457171 ATGAAGAAATGGGCTCATAAAGG + Intronic
1062662756 9:137647432-137647454 GTGCAGAAGCTGTGTCATAAAGG - Intronic
1189287899 X:39865177-39865199 CTGTGGAAACTGACTCCTAAGGG + Intergenic
1193652297 X:84152068-84152090 CTGAAGACACTGTTGCATAAAGG + Intronic
1193682470 X:84539620-84539642 CTAAAGAAACTGTCCAATGAGGG + Intergenic
1194423922 X:93713480-93713502 ATGAAGAAATTGTGTCATAGAGG - Intergenic
1195763007 X:108267201-108267223 CTGAAGACAGTGTGTCAGAATGG - Intronic
1196058919 X:111386532-111386554 CTGAAGAGTCTGTTTCCTAACGG - Intronic
1196225687 X:113163846-113163868 CTGAACTAACTTTCTCTTAACGG - Intergenic
1197735437 X:129847380-129847402 ATGAAGAAATAGTCTCAGAAAGG - Intergenic
1198621419 X:138515480-138515502 CTACAAAAACTGTCTCAAAAAGG + Intergenic
1200768436 Y:7101561-7101583 CTGATAAAAATGTCTCATGAAGG - Intergenic