ID: 1121750040

View in Genome Browser
Species Human (GRCh38)
Location 14:96345360-96345382
Sequence CTGGTTCTGAGCCTATGTAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121750040 Original CRISPR CTGGTTCTGAGCCTATGTAT TGG (reversed) Exonic
905124750 1:35708516-35708538 CTGGTTCAGAGCCTACGGGTTGG + Intergenic
908451048 1:64255286-64255308 CTGGTTCTGAGCTTTTTTTTTGG - Intronic
908995079 1:70141803-70141825 CAGGTTTTGTGTCTATGTATAGG + Intronic
911216082 1:95196639-95196661 CTGGTTTTGGTCTTATGTATAGG - Exonic
914508672 1:148310914-148310936 CTGCTGTTGAGCCTATGTGTTGG - Intergenic
918663300 1:187116341-187116363 CTGGTTCTTTGCCTGTGTGTAGG - Intergenic
919539810 1:198832251-198832273 CTGGTTCTGAGGCTAGGTCAAGG - Intergenic
921276625 1:213526956-213526978 CTGGTACTGAGCCAATTCATTGG + Intergenic
1065835853 10:29657587-29657609 CTGGCTCTGCTCCTATGTAAAGG + Intronic
1067228303 10:44389507-44389529 CTGGTTCTGGGCACATGTGTGGG + Intergenic
1071877864 10:89861941-89861963 CTGGTTCTGAGTTTATCTTTAGG + Intergenic
1073749508 10:106508303-106508325 CAGGTTCTCAACCTATATATTGG - Intergenic
1074069845 10:110055730-110055752 ATGGATCTTAGTCTATGTATTGG + Intronic
1074107530 10:110399721-110399743 CAGGTTCTTTGCCTATATATTGG + Intergenic
1077580496 11:3414257-3414279 CTGGTTCTCGGCCTATCTAGAGG + Intergenic
1084237428 11:67797086-67797108 CTGGTTCTCGGCCTATCTAGAGG + Intergenic
1084834976 11:71795742-71795764 CTGGTTCTCGGCCTATCTAGAGG - Intronic
1084995064 11:72968492-72968514 GTTATTCTGATCCTATGTATTGG - Intronic
1085842692 11:80030860-80030882 CTGCTTCTAAGGCTATGTATGGG - Intergenic
1089212285 11:116813710-116813732 CTGGTTCTGAGATAATGGATTGG - Intergenic
1089590042 11:119534147-119534169 CTGGCTCTGAGCCCAGATATTGG - Intergenic
1090765672 11:129874129-129874151 CTGGTTCTGAGACTGTGGAAGGG + Exonic
1092408088 12:8234678-8234700 CTGGTTCTTGGCCTATCTAGAGG + Intergenic
1097690367 12:62729061-62729083 CTGGTACTTAGCATATGTAAGGG - Intronic
1098171944 12:67755938-67755960 GTGGTTTTGAGTCTCTGTATCGG + Intergenic
1099995243 12:89771059-89771081 GTGGTTCTGGGCCTATAAATTGG + Intergenic
1100016106 12:90012672-90012694 TTGATTCTGAGACTATGAATTGG - Intergenic
1101343639 12:103865065-103865087 CCAGTTCTGAGCCTAAGTCTAGG + Intergenic
1102024573 12:109706959-109706981 CTGGGTCTGAGCCCAGGTCTGGG + Intergenic
1120364904 14:83555292-83555314 CTGGTTCTGATATTATGTAATGG + Intergenic
1121750040 14:96345360-96345382 CTGGTTCTGAGCCTATGTATTGG - Exonic
1121988549 14:98531671-98531693 CTGGTTTTGTGCCTAGGTCTGGG - Intergenic
1122841621 14:104467309-104467331 CTGGTTCTGAGTCTGTAGATTGG + Intergenic
1123981050 15:25603579-25603601 CTGGTTCTGGGCCTTTCTTTAGG + Intergenic
1126329034 15:47512103-47512125 GTGGTTGTCAGCTTATGTATTGG - Intronic
1133349044 16:5089509-5089531 CTGGTTCTTGGCCTATCTAGAGG + Intronic
1134808397 16:17145411-17145433 CTGGGTCTGAGACTAGGTCTTGG + Intronic
1135668837 16:24357771-24357793 CTGGTACTGATCCTCTGGATCGG - Intronic
1145779169 17:27550718-27550740 CTGGTTCTCAGCATAGGGATAGG + Intronic
1149146746 17:53503134-53503156 CTGCCTCTGAGCCTTTGTACAGG + Intergenic
1150203468 17:63380783-63380805 CTGGCTCTGTGCTTATATATTGG - Intronic
1153916020 18:9745314-9745336 CTGGTCCTGAGCCTTTCTTTTGG - Intronic
1160398781 18:78593449-78593471 CTGGCTCTGAGGCTGTGTGTGGG - Intergenic
1160823560 19:1069013-1069035 GTGTTTCTGAGCCTGTGCATGGG - Intronic
1164451987 19:28374236-28374258 CTGGTTCTGAGACCTTTTATTGG + Intergenic
925458403 2:4039079-4039101 TTGATTCTGATACTATGTATTGG - Intergenic
926134080 2:10324586-10324608 CTGGTTTTCAGCCTATGTTTTGG + Intronic
926647337 2:15303993-15304015 CTGCTTCTGAGCCTTGGTGTTGG - Intronic
927184548 2:20473040-20473062 TTGGTTCTGAGTCTGTGGATGGG - Intergenic
930094068 2:47553099-47553121 CTGGTTCTCAGGCTATGCAAGGG + Intronic
930238773 2:48914279-48914301 CCTGTTTTGAGCCTTTGTATAGG - Intergenic
931666144 2:64610717-64610739 CTGCTTCTAAGCCTTTGAATGGG + Intergenic
931792072 2:65672549-65672571 CTGGATTTGAGACTATGTACTGG - Intergenic
937161653 2:119768487-119768509 CTGTTTCTATGCCTATGTACAGG + Intronic
939264178 2:139850430-139850452 CTGATTTTGAGGCTATGTAAAGG - Intergenic
940410391 2:153356687-153356709 CTTGTTGAGAGCCTGTGTATGGG + Intergenic
945880096 2:215315986-215316008 CTGCTTCTGAGCATATTTTTGGG + Intronic
1169740524 20:8888740-8888762 TTGGTTGTGGGCCTATGGATGGG + Intronic
1172601140 20:36183814-36183836 CTGATTCTGAGTCTATGCCTTGG + Intronic
1173292295 20:41725603-41725625 CTGATTCTCAGACTATGGATGGG + Intergenic
1174282138 20:49447130-49447152 CTGGTTTTGTGCCAATGTTTGGG - Intronic
1179382880 21:40915558-40915580 CTGGTTGTGAGGCTTTGGATTGG + Intergenic
1182040833 22:27237756-27237778 CTAGTTCTGTGCCTTTGCATGGG + Intergenic
956737995 3:72253331-72253353 CTGGTTCTGAGTCCATCTATGGG - Intergenic
956839379 3:73123238-73123260 CTACTTCTGAGCCTATGTTCTGG + Intergenic
957053369 3:75426852-75426874 CTGGTTCTCGGCCTATCTAGAGG + Intergenic
960434884 3:117614111-117614133 CTGTTTATTAGCCTAAGTATTGG - Intergenic
961301455 3:125924692-125924714 CTGGTTCTCAGCCTATCTAGAGG - Intergenic
961887016 3:130103166-130103188 CTGGTTCTGGGCCTATCTAGAGG + Intronic
962846145 3:139275407-139275429 CTGGGTCAGAGCCTATGTGAGGG + Intronic
965414486 3:168375481-168375503 CTGCTTCTGAGCCTTCGCATTGG - Intergenic
969757819 4:9161523-9161545 CTGGTTCTCGGCCTATCTAGAGG - Intergenic
969817800 4:9699071-9699093 CTGGTTCTCGGCCTATCTAGAGG - Intergenic
976783546 4:88789851-88789873 CTGCCTCAGAGCCTTTGTATTGG - Intronic
979065054 4:116120921-116120943 CTGATTCTGAGGCTCTGAATTGG + Intergenic
979901319 4:126221920-126221942 CAGATTCTGAGCCTCTGGATAGG - Intergenic
981229089 4:142331961-142331983 CTGGTTATGAGCCTATTTATGGG - Intronic
1001934502 5:175694717-175694739 CTTGTTCTGAGCCTCTGGATGGG + Intergenic
1008689635 6:53963366-53963388 CTGATACTGAGCCTATTTACAGG - Intronic
1011640951 6:89415354-89415376 CTGGAGCTCAGCCTATGTCTGGG + Intergenic
1014282781 6:119460514-119460536 CTGGCTCTGAGTCCAAGTATGGG + Intergenic
1019726662 7:2606597-2606619 CTGGTTCTCAGCCTCTGTGGTGG + Intronic
1020320446 7:6935579-6935601 CTGGTTCTCGGCCTATCTAGAGG + Intergenic
1024975769 7:55112484-55112506 CTGATTCTGAGGCCATGTCTAGG - Intronic
1028780377 7:94728771-94728793 CTGGGTTCGAGCCTCTGTATAGG + Intergenic
1030110842 7:106025268-106025290 ATGGTTCTGAGCCTGAGTTTTGG + Intronic
1030744615 7:113150191-113150213 CTGCTGCAGACCCTATGTATTGG - Intergenic
1034725524 7:153331968-153331990 CCAGTTCTGAGCCTGTGTGTGGG + Intergenic
1036381073 8:8236851-8236873 CTGGTTCTCGGCCTATCTAGAGG - Intergenic
1042449537 8:68928601-68928623 GTGGTACTGAGCCTATATTTAGG - Intergenic
1043140940 8:76589700-76589722 CTGTTTCTTAGCCTGGGTATAGG + Intergenic
1043553425 8:81401551-81401573 CTGGTTCTTAGCCAGTGTGTTGG + Intergenic
1044369365 8:91390554-91390576 CAGCTTCTGAGCCTGTGAATCGG + Intronic
1047746927 8:127852067-127852089 CTGCTGCTGAGCCTGGGTATGGG - Intergenic
1049981800 9:910759-910781 CTGGTTCAGAGACTTTGGATGGG + Intronic
1050823601 9:9914711-9914733 CTGGTAGTCAGCTTATGTATGGG - Intronic
1054951647 9:70858698-70858720 CTGGCTCTGAGGCTAGGTCTCGG - Intronic
1062214207 9:135380358-135380380 CCGGTTCTCAGCCTTTGTACTGG - Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1190796923 X:53754546-53754568 CTTGTTCTGAGCCTAGCGATCGG + Intergenic
1191991538 X:67041951-67041973 CTGCCTCTGAGGGTATGTATAGG + Intergenic
1199732575 X:150650944-150650966 CTGTTTCTGGGCCTTTGTCTAGG + Intronic
1201852213 Y:18497792-18497814 CTTGTTCTGAGCCTCAGTGTAGG - Intergenic
1201881108 Y:18822592-18822614 CTTGTTCTGAGCCTCAGTGTAGG + Intronic