ID: 1121753734

View in Genome Browser
Species Human (GRCh38)
Location 14:96383299-96383321
Sequence CTACCTGGGAGGCTTAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4636
Summary {0: 1, 1: 5, 2: 40, 3: 601, 4: 3989}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121753725_1121753734 7 Left 1121753725 14:96383269-96383291 CCAACATGGCAGCACTTGCCTGT 0: 1
1: 0
2: 2
3: 61
4: 567
Right 1121753734 14:96383299-96383321 CTACCTGGGAGGCTTAGGAGGGG 0: 1
1: 5
2: 40
3: 601
4: 3989
1121753724_1121753734 8 Left 1121753724 14:96383268-96383290 CCCAACATGGCAGCACTTGCCTG 0: 1
1: 1
2: 17
3: 196
4: 2260
Right 1121753734 14:96383299-96383321 CTACCTGGGAGGCTTAGGAGGGG 0: 1
1: 5
2: 40
3: 601
4: 3989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121753734 Original CRISPR CTACCTGGGAGGCTTAGGAG GGG Intronic
Too many off-targets to display for this crispr