ID: 1121757709

View in Genome Browser
Species Human (GRCh38)
Location 14:96416984-96417006
Sequence GTGAACCATAAGAGAACCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121757709_1121757716 22 Left 1121757709 14:96416984-96417006 CCTATGGTTCTCTTATGGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1121757716 14:96417029-96417051 CTGGCAGCCGTTGAAGACAAAGG 0: 1
1: 0
2: 0
3: 3
4: 113
1121757709_1121757712 3 Left 1121757709 14:96416984-96417006 CCTATGGTTCTCTTATGGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1121757712 14:96417010-96417032 ATGGAATGTGACCATTTCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 192
1121757709_1121757717 23 Left 1121757709 14:96416984-96417006 CCTATGGTTCTCTTATGGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1121757717 14:96417030-96417052 TGGCAGCCGTTGAAGACAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 122
1121757709_1121757719 28 Left 1121757709 14:96416984-96417006 CCTATGGTTCTCTTATGGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1121757719 14:96417035-96417057 GCCGTTGAAGACAAAGGGTAGGG 0: 1
1: 0
2: 0
3: 5
4: 77
1121757709_1121757718 27 Left 1121757709 14:96416984-96417006 CCTATGGTTCTCTTATGGTTCAC 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1121757718 14:96417034-96417056 AGCCGTTGAAGACAAAGGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121757709 Original CRISPR GTGAACCATAAGAGAACCAT AGG (reversed) Intronic
906648868 1:47496163-47496185 GTGAACTATAAGTGCACCACTGG - Intergenic
908436788 1:64114725-64114747 GTGAACGATGAGGGAATCATAGG + Intronic
911213753 1:95169274-95169296 GGGAACTACACGAGAACCATTGG + Intronic
913135054 1:115880261-115880283 GTGTACCATGAGAGTACCACAGG + Intergenic
917684236 1:177399884-177399906 TAGAACCATAAGAGACCCACTGG - Intergenic
917923033 1:179766630-179766652 GTGAAACTTCAGAGAACCAAAGG + Intronic
917996757 1:180447354-180447376 GTGGACTATAAGAGAATCTTCGG - Intronic
920517189 1:206593884-206593906 GTGAACCATCAGAGAACACAGGG - Intronic
922275738 1:224076196-224076218 GTGAACCAGCAGAGCACCCTAGG - Intergenic
923892988 1:238236205-238236227 ATGACCCTTAAGAGAAACATAGG - Intergenic
1064689616 10:17901837-17901859 GTGATCCAAATGATAACCATTGG + Intronic
1067551033 10:47236695-47236717 GTGAACCAGATGAGCCCCATTGG + Intergenic
1071274838 10:84044146-84044168 ATGAACAACATGAGAACCATAGG - Intergenic
1075416684 10:122269444-122269466 GTGCACAATGAGAGAACCAGTGG - Intergenic
1077959424 11:7058214-7058236 GTGAAGGAGAAGAGAAGCATGGG + Intronic
1080051355 11:27862329-27862351 CTGAACCATCAGGGAACCTTGGG - Intergenic
1080132395 11:28812204-28812226 GGGAACCCTAAGAGAGCCAAAGG - Intergenic
1082724218 11:56715957-56715979 GTAAACCATAAGACAGCCACAGG + Intergenic
1085670256 11:78457284-78457306 GGGAACCAAAAGAGAAGGATGGG - Intronic
1086830835 11:91561190-91561212 GTGAGCCATTAGAGAACTCTTGG + Intergenic
1090005573 11:122999382-122999404 GTGACACAGAAGAGAACCCTTGG - Intergenic
1090051314 11:123382234-123382256 GTGAATCATAACAGAAGGATTGG + Intergenic
1093284759 12:17245337-17245359 GTGAACCATTAGCTAAGCATGGG + Intergenic
1096890460 12:54765316-54765338 GTGAACAATCAGAGAAGCAAGGG + Intergenic
1099292996 12:80795207-80795229 GTGAAACTTAAGAGAACCACAGG + Exonic
1099567336 12:84269347-84269369 GTGAACCTTCAGAGAACAAGAGG - Intergenic
1099866390 12:88287603-88287625 CTGGACCAGAAGAGAAACATTGG + Intergenic
1100644491 12:96514858-96514880 TTCAACCATAAGGAAACCATGGG + Intronic
1107040365 13:35941420-35941442 GTGATCCATAAGAGAAGCTGAGG + Intronic
1108643209 13:52402376-52402398 CTGAAGCATAAGAGAACCCAGGG + Intronic
1109141229 13:58715410-58715432 GTGAACCTTCAGAGAATGATGGG + Intergenic
1110135136 13:72058460-72058482 ATGGAACATAAGAGACCCATGGG - Intergenic
1118332236 14:64823615-64823637 CTGACCCATATGGGAACCATGGG + Intronic
1119021579 14:71120589-71120611 GTGAAACATAGGGGAAGCATTGG + Intergenic
1120964666 14:90156801-90156823 GTGAGGCAGAAGAGCACCATGGG - Intronic
1121757709 14:96416984-96417006 GTGAACCATAAGAGAACCATAGG - Intronic
1122159446 14:99772854-99772876 GTCAAGCATCAGAGCACCATGGG - Intronic
1122173003 14:99892440-99892462 GTAAACCTTAAGAGAGCTATAGG + Intronic
1127511862 15:59650314-59650336 GAAAACCATAACAGAACCTTGGG + Intronic
1132060890 15:98691661-98691683 ACTAACCATAAGAAAACCATGGG - Intronic
1132102776 15:99037076-99037098 GTGATCCAGAAGTGAACCAATGG + Intergenic
1139431873 16:66915137-66915159 CTGAACCATAAGACAAGCATGGG - Intronic
1143304464 17:5934934-5934956 TTGAACCATAAGACATCCGTAGG - Intronic
1143576319 17:7795616-7795638 GTGAACCATGATTGCACCATTGG + Intronic
1143840952 17:9731335-9731357 AGAAAGCATAAGAGAACCATTGG + Intergenic
1154065412 18:11102722-11102744 GTGGGCCATAGGAGAATCATGGG - Intronic
1157938034 18:51894599-51894621 GTAATCCTTAAGAGCACCATAGG + Intergenic
1158007387 18:52688007-52688029 CTGAACTATAAGGAAACCATGGG + Intronic
1158220295 18:55143655-55143677 GTCTACCACAAGAGAACCTTGGG + Intergenic
1158933932 18:62347473-62347495 TTGAACCAGAAGGGAACCAGAGG + Intronic
1163486150 19:17587548-17587570 GTGAACCATGATTGCACCATTGG - Intergenic
925369255 2:3332218-3332240 ATGAACCTTAAGAAAACCGTGGG + Intronic
925812035 2:7710387-7710409 GTGAACCCTTAGAGAACCAAGGG - Intergenic
926932347 2:18053206-18053228 GCTAGCCATAAGACAACCATTGG + Intronic
928420826 2:31137183-31137205 GTGAACCTTCGGAGAGCCATGGG + Intronic
929402928 2:41606439-41606461 GGAAACCATAAGAGAAGCACAGG - Intergenic
930088241 2:47513637-47513659 GGGACCCATGAGATAACCATGGG - Intronic
932471465 2:71962138-71962160 ATGAACCATGAGAGAACCGTGGG - Intergenic
933017600 2:77148867-77148889 GTCAACCATATGAGAACTAAAGG - Intronic
937055668 2:118934156-118934178 GTGAGCCATACAAGAAACATTGG + Intergenic
937511386 2:122599082-122599104 GTGAACCTTCAGAGGACCAATGG - Intergenic
938449928 2:131409015-131409037 GTGAACTATGAGAGAAGCCTGGG + Intergenic
944129751 2:196334852-196334874 GTGAACCCTCACAGAACCTTGGG + Intronic
944319803 2:198326345-198326367 GTAAACTATAAGAGAATCTTAGG - Intronic
944879444 2:203996645-203996667 GTGAACAATAAGAGAGCCTCAGG - Intergenic
946681483 2:222221622-222221644 ATGAACCTTATGAGGACCATGGG + Intronic
949055313 2:241924972-241924994 GTGCACCAGGAGAGAACGATGGG - Intergenic
1169475181 20:5924485-5924507 ATGAACAATAAGAGGACCAAGGG - Intronic
1174064904 20:47857348-47857370 GTGAACCAGAAAACACCCATTGG + Intergenic
1176346418 21:5752387-5752409 CTGACTCATAAGAGGACCATGGG + Intergenic
1176353232 21:5872971-5872993 CTGACTCATAAGAGGACCATGGG + Intergenic
1176498409 21:7572068-7572090 CTGACTCATAAGAGGACCATGGG - Intergenic
1176540739 21:8150457-8150479 CTGACTCATAAGAGGACCATGGG + Intergenic
1176559690 21:8333502-8333524 CTGACTCATAAGAGGACCATGGG + Intergenic
1180973924 22:19834153-19834175 ATGAACCATAAACGAACCATAGG + Intronic
1203245682 22_KI270733v1_random:66875-66897 CTGACTCATAAGAGGACCATGGG + Intergenic
951507144 3:23459922-23459944 GTTAACCATAAGAGAACTGTTGG - Intronic
952723113 3:36554233-36554255 GTGAACCATAAGAGCATGCTGGG + Intergenic
959473746 3:106784762-106784784 GTGAACCTTCAGAGAACCAAGGG - Intergenic
961100874 3:124197921-124197943 GTGCACCATAAGAGAGCTGTGGG - Intronic
961106521 3:124247246-124247268 GAGAACCAGAATAGAACCATTGG - Intronic
961500624 3:127330666-127330688 GTGAAGCATAAGACACCTATGGG + Intergenic
962205135 3:133428206-133428228 GTGGCCCACAAGAGAACCCTAGG - Intronic
962429190 3:135303712-135303734 GTGAAGCATGAGAAAACAATGGG + Intergenic
965046244 3:163581738-163581760 ATGTACCATCAGAGAACTATTGG - Intergenic
966625277 3:182009021-182009043 GTCAAGGATAAGAGAAACATAGG - Intergenic
969555524 4:7906254-7906276 GTGAGCCACAAGAGAATCAGGGG + Intronic
971931289 4:33086935-33086957 GTGAACCATAACAATACCACGGG - Intergenic
972145686 4:36021776-36021798 GAGAAAAATAAGAGAACCATTGG + Intronic
973030401 4:45330822-45330844 GAGAAACAAAAGAGAAGCATTGG + Intergenic
973847820 4:54931030-54931052 TGGACCCATAAGAGACCCATAGG - Intergenic
974330782 4:60475532-60475554 GTAAACACTAAGAGAAGCATAGG + Intergenic
975202015 4:71602328-71602350 GAAAAACATAAGAGAATCATAGG + Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
976596652 4:86901280-86901302 CTGAATGAAAAGAGAACCATTGG - Intronic
982284419 4:153720041-153720063 GTGAACCAAAAGAGTTCCAAAGG + Intronic
982905137 4:161058633-161058655 GTGTAGAATAAAAGAACCATTGG - Intergenic
988944498 5:36182480-36182502 CTGAACAAAAAGAGAATCATAGG + Exonic
991998818 5:72416027-72416049 GTGAACCAAAAGAAAATCACAGG + Intergenic
992673935 5:79086329-79086351 CTGGACCACAAGAGAACAATGGG - Intronic
993018351 5:82562740-82562762 AAGAACCATAGGAGAAACATAGG - Intergenic
993146256 5:84096829-84096851 GTGAAAGATAAGTGAATCATGGG + Intronic
995748194 5:115426053-115426075 GGGATCCATGAGAGAACCAGTGG - Intergenic
998584959 5:143417914-143417936 ATGAAACCCAAGAGAACCATAGG + Intronic
1005167031 6:22936745-22936767 GGGAAAGATAAGAGTACCATGGG - Intergenic
1005390177 6:25324895-25324917 GTGAACCCTAAGAGGACCACTGG + Intronic
1007311313 6:40948082-40948104 GTGATCCTCAAGAGAACCCTGGG - Intergenic
1011339507 6:86297992-86298014 TAGAACCATAATAAAACCATTGG + Intergenic
1012700008 6:102444128-102444150 GTGAAGAATAACAGAACCAGGGG + Intergenic
1021963711 7:25897066-25897088 GGGCACCATCAAAGAACCATTGG + Intergenic
1022278851 7:28884684-28884706 GGGAAACATAACAGAACCTTTGG + Intergenic
1027561554 7:79738414-79738436 GTGAATTTTAAGAGAACCAGAGG + Intergenic
1031814150 7:126411678-126411700 GTGAACCATGAGTGAAGCAGAGG - Intergenic
1032373807 7:131388433-131388455 TTGAACTATAAAAGAAACATTGG + Intronic
1037702773 8:21290100-21290122 CTGACCCATCTGAGAACCATGGG + Intergenic
1041315182 8:56553829-56553851 GAGAACAATGAGAAAACCATAGG - Intergenic
1047102769 8:121696256-121696278 GTAAACCATCAGATAAGCATGGG + Intergenic
1047680112 8:127246003-127246025 GTAAACCATAAGTGAGCCAAAGG + Intergenic
1048009958 8:130447593-130447615 GAGAACCAGAGGAGAACCAGGGG + Intergenic
1051101149 9:13523233-13523255 TTTAACCATAATATAACCATGGG - Intergenic
1203462019 Un_GL000220v1:49947-49969 CTGACTCATAAGAGGACCATGGG + Intergenic
1185601339 X:1341763-1341785 GTGAGCCAAAGGAGGACCATCGG - Exonic
1185817209 X:3167289-3167311 GTGAGCAGGAAGAGAACCATGGG + Intergenic
1185891071 X:3822496-3822518 GTCAACCAAAAGAAACCCATTGG - Intronic
1185896175 X:3860912-3860934 GTCAACCAAAAGAAACCCATTGG - Intergenic
1185901294 X:3899338-3899360 GTCAACCAAAAGAAACCCATTGG - Intergenic
1185906403 X:3937770-3937792 GTCAACCAAAAGAAACCCATTGG - Intergenic
1188849324 X:35112362-35112384 GTAAACCTTAAGAAAACTATGGG - Intergenic
1190855181 X:54287253-54287275 TAGAACAATAAGAGAACCATAGG + Intronic
1192531907 X:71895330-71895352 TAGAAGCATAAGAGAACAATGGG + Intergenic
1195522954 X:105851732-105851754 GAGAACCCTAAGGGCACCATGGG + Intronic
1196412055 X:115430734-115430756 TTGAACCACAAAAGAAACATAGG + Intergenic
1201264085 Y:12189146-12189168 GTGAGCAGGAAGAGAACCATGGG - Intergenic
1201630311 Y:16064177-16064199 GGGTACCATAAGAAAACCAGAGG + Intergenic