ID: 1121759518

View in Genome Browser
Species Human (GRCh38)
Location 14:96433012-96433034
Sequence CTCTCGGCAGAAACTCTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 7, 1: 24, 2: 32, 3: 38, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121759518_1121759522 -2 Left 1121759518 14:96433012-96433034 CCTTGTAGAGTTTCTGCCGAGAG 0: 7
1: 24
2: 32
3: 38
4: 128
Right 1121759522 14:96433033-96433055 AGGTCTGCTGTTAGTCTGATGGG 0: 174
1: 1943
2: 5321
3: 3974
4: 2333
1121759518_1121759523 11 Left 1121759518 14:96433012-96433034 CCTTGTAGAGTTTCTGCCGAGAG 0: 7
1: 24
2: 32
3: 38
4: 128
Right 1121759523 14:96433046-96433068 GTCTGATGGGCTTCCCTTTGTGG 0: 5864
1: 2938
2: 903
3: 329
4: 257
1121759518_1121759524 12 Left 1121759518 14:96433012-96433034 CCTTGTAGAGTTTCTGCCGAGAG 0: 7
1: 24
2: 32
3: 38
4: 128
Right 1121759524 14:96433047-96433069 TCTGATGGGCTTCCCTTTGTGGG 0: 4645
1: 4506
2: 1938
3: 878
4: 1128
1121759518_1121759521 -3 Left 1121759518 14:96433012-96433034 CCTTGTAGAGTTTCTGCCGAGAG 0: 7
1: 24
2: 32
3: 38
4: 128
Right 1121759521 14:96433032-96433054 GAGGTCTGCTGTTAGTCTGATGG 0: 165
1: 1841
2: 5266
3: 3438
4: 1931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121759518 Original CRISPR CTCTCGGCAGAAACTCTACA AGG (reversed) Intronic
902966099 1:20004032-20004054 CTCTCAGCAGAAACTCTACAAGG + Intergenic
908937495 1:69393780-69393802 CTCTCAGCAGAAACTCTACAAGG - Intergenic
910619172 1:89234582-89234604 CTCTCAGCAGAAACCTTACAAGG - Intergenic
910996513 1:93110220-93110242 CTCTAAACAGAGACTCTACAGGG + Exonic
913035324 1:114959298-114959320 TTCTTGGCAGAAATTCTACTTGG + Intronic
913155174 1:116090211-116090233 TTCTCGGCAGAAACCTTTCAAGG - Intergenic
914540466 1:148607910-148607932 CTCTCTCCAGTAACTCTCCAAGG + Intronic
915963249 1:160284404-160284426 CTCTGGGCAGGAAGTCAACAGGG + Intronic
915992073 1:160528290-160528312 CTCTTGGCAGAAACCCTACAAGG - Intergenic
916295460 1:163214291-163214313 CTCTCCCCAGAAATTCTACTAGG + Intronic
917356244 1:174129812-174129834 CTCTCAGCAGAAACTCTACAAGG - Intergenic
917827565 1:178839311-178839333 CTCTCTGCAGAAACTCTACAAGG + Intronic
918537349 1:185588192-185588214 CTCTCAGCAGAAACCCTACATGG + Intergenic
918945470 1:191059039-191059061 CTCTCTGCAGCAACTGTAAATGG + Intergenic
920890622 1:209981807-209981829 CTCTCGGCAGAAACTTTACAAGG - Intronic
921756436 1:218862232-218862254 CTCTCGGGAGAAACTTTCCTGGG - Intergenic
923465484 1:234244460-234244482 CTCTCGGCAGGCAGTCTCCAAGG + Intronic
923875343 1:238041458-238041480 CTCTTGGCAGAAACTCTACAAGG - Intergenic
924652411 1:245941466-245941488 CTCTCAGTGGAAACCCTACAAGG + Intronic
1064492701 10:15876859-15876881 CTCTCAGCAGAAACCCTACAAGG - Intergenic
1065231442 10:23602666-23602688 CTTTAGGCAGAAATTCAACAGGG + Intergenic
1065413493 10:25457955-25457977 TGCTGGGCAGAAACTTTACATGG - Intronic
1066584012 10:36912387-36912409 CTCTCGGCAGAAACTCTACAAGG - Intergenic
1069120647 10:64565800-64565822 GTCTCTGCAGAAATCCTACAAGG - Intergenic
1069670014 10:70194373-70194395 TTTTCAGCAGAAACCCTACAAGG - Intergenic
1071430073 10:85600481-85600503 ATCTCTCTAGAAACTCTACAAGG + Exonic
1074016562 10:109540923-109540945 CTGTCAGCAGAAACCCTACAAGG - Intergenic
1075493944 10:122901879-122901901 TTCTCAGCAGAAACCCTGCAAGG + Intergenic
1076185328 10:128442179-128442201 CTCTTAGCAGAAACCCTACAAGG + Intergenic
1076348908 10:129801326-129801348 CTCTCTGCAGAAACTGTAAGCGG + Intergenic
1077990929 11:7411554-7411576 TTCTCAGCAGAAACAATACAGGG - Intronic
1078033871 11:7782130-7782152 CTCTCAGCAGAAACCTTATAAGG + Intergenic
1079267244 11:18945046-18945068 CTCTTTGCAGGAACTCCACAAGG + Intergenic
1079577651 11:22022909-22022931 CTCTTAGCAGAAACTCTACAAGG - Intergenic
1080334718 11:31182377-31182399 CTCTCTGCAGAAACCCTACCAGG + Intronic
1080958866 11:37134217-37134239 CTTTCAGCAGAAACCTTACAGGG + Intergenic
1082947745 11:58777696-58777718 TTTTCAGCAGAAACTCTAAAAGG + Intergenic
1084358492 11:68654444-68654466 CTCTCCCCAGAAACCCTTCATGG + Intergenic
1087309889 11:96529137-96529159 CTCTTAGCAGAAACTCTACAAGG + Intergenic
1087378423 11:97372880-97372902 TTTTCAGCAGAAACTTTACAAGG + Intergenic
1089715921 11:120359179-120359201 CTGTGGGAAGAAACTATACAAGG + Intronic
1090103609 11:123828534-123828556 CTCTTGGCAGAAACACTACAAGG - Intergenic
1093382859 12:18516315-18516337 TTCACGGCAGAAACCCTGCAGGG - Intronic
1094732815 12:33198209-33198231 CTCTCTGCAGAAACCCTACAAGG - Intergenic
1094810718 12:34135115-34135137 CTGTCTGCAGAAAATCTACAAGG + Intergenic
1094858556 12:34432785-34432807 CCCTCGGCAGAAACTCTACAAGG + Intergenic
1095665338 12:44790275-44790297 TTCTCAGCAGAAACTCTACAAGG + Intronic
1096029726 12:48402588-48402610 CTCTCAGCAGAAACCCGACAAGG - Intergenic
1098198394 12:68027211-68027233 CTCTTGGGATAAACTCTACTTGG - Intergenic
1098733535 12:74067714-74067736 CTCTCAGCAGAAACTTTGCAAGG + Intergenic
1099511868 12:83548715-83548737 CTCTCAGCAGAAACACTACAAGG - Intergenic
1099825727 12:87775025-87775047 CTTTCAGCAGAAACCCTAAAAGG + Intergenic
1100679838 12:96907278-96907300 CTCTCCGCAGCAACACAACAGGG - Intronic
1101559331 12:105841048-105841070 TTCTGGGCAGACACTCCACAAGG + Intergenic
1103970556 12:124668218-124668240 CTCCAGGGAGAAACTCTCCACGG - Intergenic
1105072896 12:133246722-133246744 ATCTCAGCAGAAACTCTACAAGG + Intergenic
1108479876 13:50857712-50857734 CTCTCAGCAGAAACCCTACAAGG + Intergenic
1108526123 13:51287496-51287518 CTCTCAGCAGAAAGCCTAGAGGG + Intergenic
1109188097 13:59293494-59293516 CACTCTGCGGAAACTCTACAAGG + Intergenic
1109325951 13:60868359-60868381 TTCTCAGCAGAAACCCTACATGG - Intergenic
1109629342 13:65024170-65024192 CTTTCAGCAGAAACTCTACAAGG - Intergenic
1110199536 13:72832607-72832629 CTCTCTGCAGAAACCCTACAAGG - Intronic
1110531461 13:76603324-76603346 CTCCCAACAGAAACTCTACCTGG + Intergenic
1110901271 13:80828220-80828242 ATCAAGGCAGAAAATCTACAAGG - Intergenic
1116792340 14:49352901-49352923 CTCCCTGCAGAAACCCTACAAGG - Intergenic
1116792895 14:49358376-49358398 CTCTCTGCAGAAACCCTACAAGG + Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1117859555 14:60075248-60075270 CTGTCTGCAGAAACCCTACAAGG + Intergenic
1119100628 14:71877018-71877040 CTCTTGGCAGAAACTCTACAAGG - Intergenic
1120565155 14:86046682-86046704 TTCTCTGCAGAAACCCAACAAGG - Intergenic
1121398729 14:93652701-93652723 CTCTTGGAATAAACTCTACTTGG + Intronic
1121759518 14:96433012-96433034 CTCTCGGCAGAAACTCTACAAGG - Intronic
1124151028 15:27178338-27178360 CTCTTGACAAAAACTCTGCAAGG + Intronic
1126304393 15:47238701-47238723 CTCAGGCCAGAAAATCTACATGG - Intronic
1128649046 15:69397177-69397199 CGCTGGGCAGAAACCCTTCAAGG - Intronic
1129559878 15:76554734-76554756 CTTTCAGCAGAAATCCTACAAGG + Intronic
1129568797 15:76655710-76655732 CTTTCAGCAGAAACACTATAAGG + Intronic
1130273868 15:82466509-82466531 CTCTTGGGAGAAGCTCTGCACGG - Intergenic
1130466216 15:84193883-84193905 CTCTTGGGAGAAGCTCTGCACGG - Intergenic
1130498047 15:84479653-84479675 CTCTTGGGAGAAGCTCTGCACGG + Intergenic
1130588510 15:85198476-85198498 CTCTTGGGAGAAGCTCTGCACGG - Intergenic
1135109772 16:19681498-19681520 CTCTGTGCAGAAGCTCTGCACGG - Intronic
1138961033 16:62029574-62029596 CTCTCGGCAGAAAATAGTCATGG - Intronic
1146758859 17:35458103-35458125 CTCTCAACAGAAACCCTACAAGG - Intergenic
1148408086 17:47438123-47438145 TTCTCAGTAGAAACCCTACAAGG - Intronic
1149395857 17:56243000-56243022 TTCTTGGCATAAACTCTACTTGG + Intronic
1149731301 17:58949048-58949070 ATCTAGGCAGAAAATCAACAAGG - Intronic
1151445937 17:74164021-74164043 CTCTAGCCAGTAACTCTCCAAGG + Intergenic
1153524344 18:5980256-5980278 TTCTCAGCAGAAACTCTCCTAGG + Intronic
1155774032 18:29736684-29736706 CTTTCAGAAGAAACTCTGCAAGG - Intergenic
1157066359 18:44355533-44355555 CTCTCAGCAGAAACCTTACAAGG - Intergenic
1159155798 18:64579934-64579956 CTCTCAGAAGAAACCCTATAAGG + Intergenic
1161089815 19:2354114-2354136 CTCTCAGCAGAAAAGCAACACGG - Intronic
928782910 2:34847177-34847199 TTCTCAGCAGAAACCTTACAAGG - Intergenic
929026298 2:37606328-37606350 ATCTCAGCAGAAACCCTGCAGGG + Intergenic
929991995 2:46798066-46798088 CTCTCCACAGAAACTCTATTGGG + Intergenic
930095443 2:47562795-47562817 CTCTCTGCAGAGTTTCTACACGG - Intronic
930539173 2:52682728-52682750 TTCTCAGCAGAAACCTTACAGGG + Intergenic
930627790 2:53718316-53718338 TTCTCAGCAGAAACCTTACAAGG + Intronic
930897844 2:56465948-56465970 GTCTCAGCAGAAACCTTACAAGG + Intergenic
930985938 2:57588070-57588092 CTCTCAGCAGAAACTCTACAAGG + Intergenic
933579225 2:84105797-84105819 CTCTCGGCAGAAACTCTACAAGG + Intergenic
933604078 2:84362568-84362590 ATCTCTGCAGAAATCCTACAAGG + Intergenic
933618481 2:84509917-84509939 CTCTCAGCAGAAACTCTACAAGG - Intergenic
934522177 2:95026388-95026410 CCCTCGCCAGAAACTTTAAAAGG - Intronic
935540287 2:104340290-104340312 CTCCCCGCAGAAACTCTCAATGG - Intergenic
936391089 2:112074404-112074426 CTCTCCACAGAAACCCTACAAGG - Intronic
937749480 2:125457394-125457416 CTCTCTGCTGAATCTCCACATGG + Intergenic
939398542 2:141661980-141662002 CTCTCAGCAGAAACCCTACAAGG + Intronic
942732778 2:179077697-179077719 CTCTCTGCAGAAACTCTACAAGG + Intergenic
943130149 2:183843676-183843698 CTCTCTGCAGAAACCCTCCATGG + Intergenic
943199246 2:184798079-184798101 TTCTCAGCAGAAACCCTACAAGG - Intronic
945495966 2:210507176-210507198 CTCTCGGCAGAAACTCTAGAAGG + Intronic
1169960157 20:11151125-11151147 CTCTCTGCAGAAACCCTACAAGG - Intergenic
1172917536 20:38454148-38454170 CTCCCAGCAGAAACACTGCAGGG - Intergenic
1173109647 20:40174738-40174760 CTATCGGGAGACAGTCTACAGGG - Intergenic
1181917041 22:26289830-26289852 CTCCCTGCAGAAAATCGACAAGG + Intronic
1183048198 22:35239088-35239110 TTTTCAGCAGAAACTCTACAAGG - Intergenic
1185161452 22:49232374-49232396 CTCTATGCAGAAACTTAACAGGG + Intergenic
949877875 3:8638380-8638402 CTCCTGGCAGAAAACCTACAAGG + Intronic
951326131 3:21303595-21303617 TTCTCAGCAGAAACTCTACAAGG + Intergenic
952076798 3:29706604-29706626 CTCTCACAAGAAACTCTTCAGGG + Intronic
952683753 3:36125248-36125270 TTCTCTGCAGAAACTTTACAGGG + Intergenic
958759432 3:98290300-98290322 CTCTCAGTGGAAACCCTACAAGG - Intergenic
959361944 3:105404384-105404406 TTCTCAGCAGAAACCCTACAAGG + Intronic
959953887 3:112213005-112213027 CTCTCAGCAGAAACTCTACAAGG + Intronic
960477077 3:118143624-118143646 CTCTCAGCAGAAACTCTACGAGG - Intergenic
960516697 3:118609617-118609639 TTCTCAGCAGAAACCTTACAAGG + Intergenic
963561665 3:146874083-146874105 TTTTCAGCAGAAACCCTACAAGG - Intergenic
970101357 4:12525934-12525956 CTGTCAGAAGAAACTCCACATGG + Intergenic
971708366 4:30078336-30078358 CTCTCAGCAGAAACCCTGCAAGG - Intergenic
973287715 4:48438559-48438581 TTCTCAGCAGAAACCTTACAGGG - Intergenic
975520820 4:75299321-75299343 CTCTTGGCAGAAATGCTACAAGG - Intergenic
975524420 4:75333017-75333039 CTCTCTGCAGAAACCCTACAAGG + Intergenic
975528899 4:75379908-75379930 ATCTCAGCAGAAACTCTACAAGG + Intergenic
975763770 4:77644667-77644689 TTCTAGGCAGAAAATCAACAAGG + Intergenic
976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG + Intergenic
978001976 4:103567343-103567365 CTCTCATCAGAATCGCTACAGGG - Intergenic
978055096 4:104253742-104253764 CTCTTGGCAGAAACCCTACAAGG + Intergenic
979417640 4:120462526-120462548 CTCGCTGCAGAAACCCTACAAGG + Intergenic
979421584 4:120510907-120510929 CTCTCTGCAGAAACCCTACAAGG + Intergenic
980787215 4:137571427-137571449 CTTTCAGCAGAAACCCTAAAAGG - Intergenic
983364480 4:166768529-166768551 CTCTTGACAGAAGCTCTAAAAGG - Intronic
983546864 4:168974250-168974272 TTCTCAGCAGAAACCCTGCAAGG - Intronic
985566830 5:623104-623126 CTCTCTGCAGAAACACTAAGAGG - Intronic
986259166 5:6127609-6127631 TTCTCAGCAGAAAGCCTACAAGG + Intergenic
986335410 5:6751372-6751394 CTCGCTGCTGAAACTATACATGG - Intronic
986472311 5:8088557-8088579 CTCTCGGCAGAAACCCTACAAGG - Intergenic
986907402 5:12511959-12511981 CTCTCACCAGAAACCCTGCAAGG - Intergenic
987846549 5:23294762-23294784 TTCTCAGCAGAAACCCTACTAGG - Intergenic
988194087 5:27978829-27978851 CTCTCAGCAGAACCCCTACAAGG - Intergenic
988201031 5:28068254-28068276 CTCTCAGCAGAAATTCTATAAGG + Intergenic
991247945 5:64527465-64527487 ATCTTGGCAGAAACTCTAAGTGG - Intronic
994270482 5:97770941-97770963 CTCCTGGCAGAAAGTCTACAAGG - Intergenic
994707752 5:103226260-103226282 TTCTCAGCAGAAACCTTACAAGG + Intergenic
994949000 5:106432306-106432328 TTCTCTGCAGAAACCTTACAGGG - Intergenic
995450988 5:112300489-112300511 TTCTCAGCAGAAACCCTACAAGG - Intronic
995660621 5:114478700-114478722 CCCTCAGCAGAAATCCTACAAGG + Intronic
995810956 5:116107042-116107064 CTCTCAGCAGAAACCCTAATGGG - Intronic
996648301 5:125842807-125842829 CTCTCTGCAGAAACCCTACAAGG + Intergenic
997182059 5:131840202-131840224 CTCTCAGCACAAACCCTAAAAGG - Intronic
997920098 5:137970259-137970281 CTCTCAGCAGAAACTCTACAAGG + Intronic
999839078 5:155404669-155404691 TTCTCAGCAGAAACCCTACAAGG + Intergenic
1000158901 5:158580502-158580524 TTCTCAGGAGAAACCCTACAAGG - Intergenic
1003526408 6:6901632-6901654 CACCCGGCAGAAGCGCTACAAGG + Intergenic
1005846277 6:29781549-29781571 CTCTCGGCAGAAACTCTACAAGG + Intergenic
1008340935 6:50363141-50363163 CTCTAACCTGAAACTCTACAGGG + Intergenic
1010483036 6:76377801-76377823 CTCTCAGCAGAAACTCAGAAGGG - Intergenic
1011537554 6:88392503-88392525 CCCTCGGCAGAAACTCTACAAGG + Intergenic
1013007866 6:106091169-106091191 CCGACGGCAGAAACTCTACAGGG - Intronic
1014124576 6:117761392-117761414 CTCTCCACTGAAACCCTACATGG + Intergenic
1016245136 6:141971316-141971338 CTCTCGGCAGAAACTCTACAAGG + Intergenic
1022342554 7:29482436-29482458 CTCTAGGTGGAAACTTTACATGG + Intronic
1024015408 7:45309910-45309932 TTCTCAGCAGAAACTTTACAAGG - Intergenic
1027944225 7:84724390-84724412 CTCTCAGCAGAAACTCTACAAGG + Intergenic
1029313334 7:99687820-99687842 CTCTTGGCAGAAACTCTACAAGG + Intronic
1030391028 7:108929357-108929379 CTCTCAGTGGAAACTCTACAAGG - Intergenic
1030705017 7:112683633-112683655 CTCTTGGCAGCTACTTTACAAGG - Intergenic
1031626942 7:124002991-124003013 CTCTCAGCTGAAACCCTATAAGG - Intergenic
1033272020 7:139940497-139940519 CTCTCAGCAGAATCTTTCCAGGG - Intronic
1034370592 7:150593077-150593099 CTCTCTGCAGAAACCATACGAGG - Intergenic
1035558673 8:588428-588450 CTCTCAGCAGAAACTCTACAAGG - Intergenic
1037617412 8:20531918-20531940 CTCAAGGCTGAAAATCTACATGG - Intergenic
1039719019 8:40142539-40142561 CTCTTGGCAGAAACTCTACAAGG - Intergenic
1040273472 8:45984369-45984391 CTCTCGGCAGAAACTCTACAAGG - Intergenic
1042630139 8:70807065-70807087 CTCCCAGCAGAAACCGTACAAGG + Intergenic
1043198244 8:77328656-77328678 TTATCAGCAGAAACTTTACAAGG - Intergenic
1044152285 8:88796248-88796270 CTTTCATTAGAAACTCTACAAGG - Intergenic
1045199856 8:99969037-99969059 CTCTCGGCAGAAACCCCATAGGG + Intronic
1045634693 8:104170994-104171016 TTCTCAGCAGAAAATTTACAAGG - Intronic
1045814129 8:106260129-106260151 TTCTCAGCAGAAACCTTACAAGG - Intergenic
1048126081 8:131636830-131636852 CTCTTGGCAGAAACTCTACAAGG + Intergenic
1050618429 9:7427684-7427706 TTCTCAGTAGAAACTTTACAGGG - Intergenic
1051670276 9:19503448-19503470 CTCTCTGCAGAAACCCTACAAGG - Intergenic
1051863200 9:21650183-21650205 CTCTCTGCAGAAAGCTTACAAGG - Intergenic
1052225102 9:26076472-26076494 CTCTCAGCAGAAACTCTATTAGG - Intergenic
1052800207 9:32959597-32959619 CTCTCGGCAGAAACTCTACAAGG + Intergenic
1053583089 9:39427081-39427103 CTCTCAGCAGAAACTCTACAAGG + Intergenic
1053847272 9:42251940-42251962 CTCCCAGCAGAAACTCTACAAGG + Intergenic
1054104670 9:60985824-60985846 CTCTCAGCAGAAACTCTACAAGG + Intergenic
1055895014 9:81164228-81164250 CTCTCAGCAGAAACCCTACAAGG + Intergenic
1056941673 9:90961543-90961565 CTGTCGGCAGAAACGCTCCAGGG - Intergenic
1061852946 9:133426433-133426455 TCCTCTGGAGAAACTCTACAAGG - Intronic
1187605380 X:20876383-20876405 CTCTCAGTGGAAACCCTACAAGG + Intergenic
1188967019 X:36567041-36567063 GTCTTGCCAGAAACTCTGCATGG + Intergenic
1190506073 X:51127021-51127043 CTGTCTGCAGAAACCCTACAAGG + Intergenic
1191077140 X:56467414-56467436 TTCTCAGCAGAAATCCTACAAGG - Intergenic
1191160267 X:57322341-57322363 CTCTCAGCAAAAATCCTACATGG - Intronic
1191583394 X:62791157-62791179 CACTCTGTAGAAACTGTACAGGG - Intergenic
1191919857 X:66244015-66244037 TTCTCAGCAGAAACTCTACAAGG - Intronic
1192000807 X:67149406-67149428 CTCTCAGCAGAAACCCTACAAGG - Intergenic
1192298210 X:69872047-69872069 GTCTCAACAGAAACCCTACAAGG + Intronic
1192883449 X:75312470-75312492 GCCTCTGCAGAAACCCTACAAGG - Intergenic
1193617484 X:83708190-83708212 TTCTCAGCAGAAACCTTACAAGG - Intergenic
1194098762 X:89675917-89675939 CTCTCTGAAGAAAGCCTACAAGG + Intergenic
1194465956 X:94235905-94235927 TTCTCAGCAGAAACCCCACAAGG - Intergenic
1194519379 X:94900218-94900240 CTGTCACCAGAAACCCTACAAGG - Intergenic
1195686137 X:107588094-107588116 CTCTTAGCAGAAACTCTAAAAGG - Intronic
1195733546 X:107990421-107990443 CTCTCTGGAGAAACTCTGCAAGG - Intergenic
1196280991 X:113823886-113823908 CTCTCTGCAGAAACGCTACAAGG - Intergenic
1196473540 X:116056816-116056838 CTCTCAGTAGAAACCCTACATGG - Intergenic
1196513641 X:116544889-116544911 CTCTCAGTAGAAACTCTACAAGG - Intergenic
1196631290 X:117943168-117943190 CTCTCTGCAGAAACCCTACAAGG - Intronic
1197600804 X:128526285-128526307 TTCTCTGCAGAAACCTTACAAGG + Intergenic
1199216716 X:145267392-145267414 TTGTCGGCAGAAACCCTATAAGG + Intergenic
1199243132 X:145571625-145571647 ATCTAGACAGAAACTCGACAAGG + Intergenic
1200451787 Y:3337290-3337312 CTCTCTGAAGAAAGCCTACAAGG + Intergenic
1200903501 Y:8457737-8457759 TTCTCAGCAGAAACTCTACAAGG - Intergenic
1201689824 Y:16751371-16751393 ATCTCTGCAGAAACCCTACAAGG - Intergenic