ID: 1121764580

View in Genome Browser
Species Human (GRCh38)
Location 14:96475091-96475113
Sequence CTGGACTTTCCATTCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121764577_1121764580 1 Left 1121764577 14:96475067-96475089 CCAAGGACTCTTAAACGTAGGCC 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1121764580 14:96475091-96475113 CTGGACTTTCCATTCTTTGTTGG 0: 1
1: 0
2: 0
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121764580 Original CRISPR CTGGACTTTCCATTCTTTGT TGG Intronic
901502208 1:9659723-9659745 CTGGACATTCCACTGTGTGTAGG + Intronic
904423037 1:30406287-30406309 CTGTACTTTCCACTTCTTGTGGG - Intergenic
904797130 1:33064979-33065001 GTGAACTTTCCATTCCTTTTCGG - Intronic
905494839 1:38376776-38376798 CTGGACTTCCCATGGTTTGGAGG - Intergenic
907596686 1:55726835-55726857 CTGGCCATTCCTCTCTTTGTGGG + Intergenic
908191663 1:61710120-61710142 CAGAACCTTCGATTCTTTGTAGG + Intronic
908516261 1:64895760-64895782 ATAGACCTTCCATGCTTTGTGGG - Intronic
911338971 1:96614400-96614422 CTGGACTTTCTTTTGTTGGTAGG + Intergenic
912803169 1:112734375-112734397 CTGGGCTTTTCAGTTTTTGTTGG - Intergenic
912935232 1:113998080-113998102 CTGGACTTTTCTTTCTTGGGAGG - Intergenic
913072993 1:115318068-115318090 CTGGCCTTTCGATTCTCTCTTGG + Intronic
916265771 1:162888538-162888560 CTGGACTTCCTCTTCTTTTTGGG + Intergenic
916552839 1:165865406-165865428 CTGCACTTGCCATGCTTTGCAGG - Intronic
916655340 1:166870510-166870532 GAGGATTTTCCTTTCTTTGTTGG - Intronic
916852282 1:168715703-168715725 CTGGGCTTTGCATGCTGTGTGGG - Intronic
918926992 1:190800167-190800189 CTGGACCTCTCATTCATTGTTGG + Intergenic
923448388 1:234093756-234093778 CTGGCATTTCCTTTCTTTCTTGG - Intronic
1064726047 10:18281017-18281039 CTGGGCTTTCCATATTTTGTAGG + Intronic
1065310448 10:24410831-24410853 CTGTTCTCTCCATTCTTTATGGG + Intronic
1065974345 10:30829360-30829382 ATGGCCTTTCCTTTCTTTCTGGG - Intronic
1069049117 10:63773826-63773848 CTGGATTTACCAATCTTTGCTGG + Intergenic
1070344854 10:75531730-75531752 CTGGACTGTAAATTCCTTGTGGG - Intronic
1070531990 10:77345096-77345118 CTAGAGGTTCCATGCTTTGTTGG + Intronic
1071237230 10:83663281-83663303 ATGGACTGTCCACTCTTTGGTGG + Intergenic
1071490275 10:86131476-86131498 GTGGCCTTTCCTTCCTTTGTGGG - Intronic
1071685081 10:87745915-87745937 CAGGACCTTCCATGCTTTGGGGG - Exonic
1072241645 10:93500919-93500941 CTGGCCATTCCATGCTTTTTTGG + Intronic
1073123649 10:101136497-101136519 TTGGGGTTTCCAGTCTTTGTTGG + Intronic
1073829356 10:107363983-107364005 CTGTATTTTCTCTTCTTTGTAGG + Intergenic
1074071207 10:110071853-110071875 CTGAACTTACCAATCATTGTAGG + Intronic
1075737912 10:124675375-124675397 CTGGGCTCTCCACTCTTGGTGGG - Intronic
1075742379 10:124703769-124703791 CTGAACTCTCCTTGCTTTGTTGG - Intronic
1075828600 10:125383587-125383609 CTGGACCTGACATTCTTGGTTGG + Intergenic
1078883596 11:15477860-15477882 CTGTACTTTCCAATTTTTCTGGG - Intergenic
1080079042 11:28192657-28192679 CTGGACTTTCCTTTATTAGGTGG + Intronic
1080232661 11:30035264-30035286 CTTGAATTTCCATGTTTTGTGGG - Intergenic
1080898491 11:36465906-36465928 GTGGAGTTTCCATTGTGTGTAGG + Intergenic
1087115902 11:94523978-94524000 GTGGACTTTTGATTCCTTGTAGG + Intergenic
1088469771 11:110179381-110179403 CTGGCCTTTCCATTGTCTCTAGG + Intronic
1089120768 11:116133029-116133051 CTGGACTCACAATTCTTTGCCGG - Intergenic
1090260492 11:125315442-125315464 TTGGACTTTCTATTATTTATTGG + Intronic
1090311161 11:125742143-125742165 CTGGACACACCATTCTATGTTGG + Intergenic
1091139216 11:133220963-133220985 ATGGCCCTTCCATTTTTTGTCGG + Intronic
1091189728 11:133681111-133681133 CTGGACTATGCATTCTTTAATGG + Intergenic
1092090234 12:5798151-5798173 CTGATCATTCCATTCTTGGTGGG - Intronic
1092090962 12:5803434-5803456 CTGGATTTTCCAGCCTTTGCAGG - Intronic
1098036628 12:66309710-66309732 CAGGAGTTTCCACTCTCTGTAGG - Exonic
1098560843 12:71870162-71870184 CTGGGATATCCATTCTTTGGGGG - Intronic
1104466358 12:128993994-128994016 CTGGACTTTCCTTTTTTGGGGGG - Intergenic
1104632962 12:130419653-130419675 CTGGACTTTCCTCACTTTGTAGG + Intronic
1105686763 13:22791435-22791457 CTGGATTCTTCATGCTTTGTTGG + Intergenic
1107039080 13:35930329-35930351 CAGGACTTTCCTTTCAGTGTGGG - Intronic
1108403850 13:50081065-50081087 CTGGACTTTAGCTTCTTTCTGGG - Intergenic
1108717790 13:53099025-53099047 CTGGACTTTTTTTTCTTTGCAGG + Intergenic
1112553214 13:100442573-100442595 CTGGGCGTTCCCTTCTATGTAGG - Intronic
1113402811 13:110010248-110010270 CTCCATTTTCCATTCCTTGTTGG + Intergenic
1115694954 14:35886969-35886991 CTGGACTCTCCATTCTCCATTGG - Intronic
1116340030 14:43711104-43711126 CTACACTTTTCATCCTTTGTGGG + Intergenic
1117629907 14:57680063-57680085 CTGAAATTTCCTTTTTTTGTTGG - Intronic
1121764580 14:96475091-96475113 CTGGACTTTCCATTCTTTGTTGG + Intronic
1121818144 14:96943955-96943977 TGGGACTTTCCAATCTTTGCGGG - Intergenic
1122511948 14:102276160-102276182 CTGGAACTTTCATTCTTTGCCGG + Intronic
1124153968 15:27209188-27209210 CAGGACTCTCCATTCTGTTTTGG - Intronic
1126054347 15:44715455-44715477 TTTGACTTTCCATTCTCTGCTGG - Exonic
1126658511 15:51007416-51007438 CAGGAATTCTCATTCTTTGTTGG - Intergenic
1130022746 15:80244778-80244800 CTGAACTTGCCCTTCTCTGTGGG - Intergenic
1132507585 16:319388-319410 CTGGACTTTCCCTTCTGTGATGG - Intronic
1132574047 16:656628-656650 CTGGACTTTCCAGCCTGTGTCGG + Intronic
1133813509 16:9179058-9179080 CTGCACCTTTCATTCTTTATCGG + Intergenic
1135058795 16:19253533-19253555 CTAGAGTTTCCAATCTCTGTGGG - Intronic
1135078938 16:19417471-19417493 CATCACGTTCCATTCTTTGTTGG + Intronic
1135207162 16:20493128-20493150 CTGTTCTTTCCATCCTTTCTTGG + Intergenic
1135211723 16:20530504-20530526 CTGTTCTTTCCATCCTTTCTTGG - Intergenic
1138860210 16:60746641-60746663 CGGGAATTTTCATTCATTGTTGG + Intergenic
1141912444 16:87069113-87069135 CTAGACTTTCCTTTCTCTGCTGG - Intergenic
1150487917 17:65556742-65556764 CTGGATTTCCCTTTCTCTGTAGG - Intronic
1151708670 17:75786887-75786909 CCTGCCTTTCCATTCCTTGTGGG + Intronic
1153027949 18:688210-688232 AGGCACTTTCCATTCTTTGAGGG - Intronic
1153409142 18:4774084-4774106 CATGGCTGTCCATTCTTTGTTGG - Intergenic
1153470615 18:5440350-5440372 CTGGACTTTTTTTTCTTTATTGG - Intronic
1156850311 18:41718406-41718428 CTGGACTTTGCTTTCTTTCCTGG - Intergenic
1158036654 18:53039890-53039912 CTGGAATGTCCATTCCTTGAGGG + Intronic
1158160016 18:54470522-54470544 CTGGATTTTGCATTCTTACTAGG - Intergenic
1158267518 18:55676714-55676736 CTGGAATTTCCATGTGTTGTGGG - Intergenic
1158289370 18:55921779-55921801 CTGGAATTTACATTTTTTGAAGG - Intergenic
1158704005 18:59774815-59774837 CTGGACTTTCTTTTGTTGGTAGG - Intergenic
1159140182 18:64384624-64384646 CTGACCTGTTCATTCTTTGTTGG - Intergenic
1161298350 19:3531058-3531080 CTGGACCTGCCATCCTTTCTAGG - Intronic
1164816458 19:31207715-31207737 CTGGCCAATCCATTCTTTCTTGG - Intergenic
1165328973 19:35130907-35130929 CTGGACTTTGAACTCTTTGAGGG + Intronic
1167635508 19:50652708-50652730 CAGGACTTTTCATTGTCTGTGGG - Intronic
925729729 2:6910606-6910628 CAGAACTTTCCATTCTTAGGTGG + Intergenic
926780981 2:16471542-16471564 CTGGACTTTCCATCTAATGTAGG + Intergenic
927891019 2:26749316-26749338 CTGGACTTCCTATTCTTTCACGG + Intergenic
927988657 2:27431337-27431359 CTGAAGTTTCCATTCTCTGGGGG - Intronic
928477331 2:31642674-31642696 GTGGACTTTTCATTTTTTGGGGG - Intergenic
930349245 2:50228729-50228751 CACGAATTTCCATTCTTTATTGG + Intronic
930723974 2:54664813-54664835 CTGGACATTGCATTCTTCTTGGG + Intronic
931863129 2:66378357-66378379 TTGGAATTTCCATTCTTTCTTGG + Intergenic
931927350 2:67087590-67087612 CTGGATTCTTCAGTCTTTGTAGG + Intergenic
933108645 2:78367880-78367902 TAGGACTTTCCATTGATTGTAGG + Intergenic
933299414 2:80525378-80525400 CTGGATTTCCCCTTCTGTGTTGG + Intronic
935408568 2:102735784-102735806 CTAAACTTTCCATTCTACGTGGG + Intronic
936406506 2:112209528-112209550 CTGGAGATGCCATGCTTTGTGGG - Intergenic
936444831 2:112587177-112587199 CTTGACTTTCCAGTCATTCTTGG + Intronic
937186953 2:120052858-120052880 CTGGAATTTCAATTATTTATGGG - Intronic
938835416 2:135097993-135098015 CTGGAATTTTCATACATTGTTGG - Intronic
939357136 2:141116788-141116810 ATATACTTTCCAGTCTTTGTTGG - Intronic
939773107 2:146349508-146349530 TTTAACTTTCCAATCTTTGTTGG - Intergenic
940655997 2:156488733-156488755 CTTGGCTTTCAGTTCTTTGTAGG + Intronic
942173715 2:173311114-173311136 CTGGAGTTTACATTCTAGGTAGG + Intergenic
942744268 2:179213762-179213784 CAGGAGATTCCATCCTTTGTGGG - Intronic
943537333 2:189168871-189168893 CTGCACTGTTCTTTCTTTGTAGG - Intronic
944337467 2:198553397-198553419 CAGGACTTCTCATACTTTGTAGG + Intronic
945075104 2:206031041-206031063 CTGTCCTTCCCATTCTTTGTTGG - Intronic
945809586 2:214532534-214532556 ATTCACTTTCCATTTTTTGTTGG + Intronic
946637204 2:221742758-221742780 ATACACTTTCCTTTCTTTGTAGG + Intergenic
946875369 2:224124572-224124594 CTGTATTTTTCTTTCTTTGTTGG + Intergenic
948749231 2:240120977-240120999 CTGGACTCTACATTCTGTTTCGG + Intergenic
1169002801 20:2180153-2180175 CAAGAATTTCCATTCTTGGTGGG + Intergenic
1173464525 20:43270503-43270525 CTGGAGTTTACATTTTTTGTGGG - Intergenic
1174529729 20:51201615-51201637 CTGGAACTTCCATACATTGTAGG - Intergenic
1176409757 21:6442242-6442264 CTGGGCTTTTCATCCTTTTTTGG + Intergenic
1177247299 21:18544726-18544748 CTGGACTTTTCTTTTGTTGTAGG + Intergenic
1177732706 21:25049150-25049172 CTGGACTTTCTATCCCTTATTGG - Intergenic
1178581774 21:33844472-33844494 CTGAACGTTCCATTCTTTGCTGG - Intronic
1178929012 21:36800843-36800865 CTGAACTTGCTATTCTTGGTGGG - Intronic
1179685250 21:43050564-43050586 CTGGGCTTTTCATCCTTTTTTGG + Intergenic
1183191599 22:36325123-36325145 CCCGATTTTCCATTCTTTTTAGG - Intronic
1183401072 22:37605014-37605036 CTGTGCTTTCCATCCTTTGAAGG + Intergenic
953288018 3:41631953-41631975 CAGTGCTTTCCATTCTTTCTGGG + Intronic
953476461 3:43209698-43209720 CTGCACCTGCCTTTCTTTGTTGG - Intergenic
954953184 3:54492894-54492916 CTGGGCATTCCATTCTCTCTGGG - Intronic
956473771 3:69597286-69597308 CTGGTTGTTCCATTCTTAGTAGG - Intergenic
956605743 3:71071292-71071314 CTCCACTTTCCAGTCTTTGACGG + Intronic
957949346 3:87105594-87105616 CTGGAACTTCCATACATTGTTGG + Intergenic
962480529 3:135794308-135794330 CTGCCCTCTCAATTCTTTGTTGG + Intergenic
963353852 3:144185606-144185628 CTGGATTTTCTATTCTTAGAAGG + Intergenic
963386925 3:144608957-144608979 CTGGATTCTCCATGCTTTATTGG - Intergenic
964485907 3:157185158-157185180 CCTCTCTTTCCATTCTTTGTTGG + Intergenic
965859732 3:173134131-173134153 CTGGACTTTTTATTCTTTTCAGG - Intronic
966788717 3:183644579-183644601 CAGGATTTTCCATTTTTTATTGG + Intronic
967656396 3:192055225-192055247 CTGGCCTTTCTCTCCTTTGTTGG - Intergenic
967676445 3:192304504-192304526 CTGGTCTTTCCTTTCTATGCAGG - Intronic
970618542 4:17792240-17792262 CTGGAACTTCCATACATTGTTGG + Intergenic
972411030 4:38795007-38795029 ATTGACTTTCCATTCTTCCTTGG - Intronic
974915279 4:68171957-68171979 CTGGAATTTCCATGTGTTGTGGG + Intergenic
975511439 4:75197819-75197841 CTGGACATGCAATTCTTGGTTGG + Intergenic
977804555 4:101281379-101281401 CAGCATTTTCTATTCTTTGTTGG - Intronic
978553526 4:109953691-109953713 CTGGAGTTTCTAGTCTGTGTGGG + Intronic
979158200 4:117425134-117425156 CAGGACTTTCAATACTATGTGGG + Intergenic
979646976 4:123080976-123080998 CTGTACTTTCCACTCAATGTTGG - Intronic
980896594 4:138866405-138866427 CTGGACTTTCTCTTCTGTGGGGG - Intergenic
981254643 4:142647449-142647471 ATGGCCTTTTCACTCTTTGTTGG - Intronic
982785380 4:159530654-159530676 CTGGACTTTTCTTGCTTGGTAGG + Intergenic
984492159 4:180448491-180448513 CTGGACTTTCCTGTTTTTTTTGG + Intergenic
985000328 4:185476026-185476048 CTGTACTTTTCATTATTTTTAGG - Intergenic
985294330 4:188418904-188418926 CTGGCATTTCAACTCTTTGTTGG - Intergenic
986609940 5:9557104-9557126 CTGGAATCTCCATGCTGTGTTGG + Intergenic
986764382 5:10911541-10911563 CTTGACTTTCCTTTCCTTGCAGG - Intergenic
988627693 5:32895506-32895528 CTGGACTTTTCTTTGTTGGTAGG + Intergenic
988771321 5:34435866-34435888 CTGGTCTTGCCATTCCTTCTTGG - Intergenic
988800834 5:34695194-34695216 CTGGCCTGTTCATTCTTTGAAGG + Intronic
990853419 5:60234559-60234581 TTGGAATTTTCATTCATTGTTGG - Intronic
991025855 5:62028831-62028853 CTGGCTCTTCCTTTCTTTGTTGG + Intergenic
991921016 5:71657123-71657145 CAGAACTTTTCATACTTTGTGGG - Exonic
993206016 5:84879163-84879185 CTGTACTTTTAATTTTTTGTGGG - Intergenic
993810738 5:92472664-92472686 CTAGACTTTACATTCCTTGAAGG + Intergenic
993941979 5:94069535-94069557 CTGGATTATCAATACTTTGTTGG - Intronic
995547285 5:113245751-113245773 TTGGATTTTCCATCATTTGTGGG - Intronic
997256716 5:132434631-132434653 CTGCACTTTTCATTCTGTTTTGG - Intronic
998532455 5:142898536-142898558 CTGGACTTTGCATTCTGCCTTGG + Intronic
1000094538 5:157959575-157959597 CTGGACTTTCAATGGATTGTAGG + Intergenic
1001141024 5:169144182-169144204 CTTTATTTTCCATTCTTTGAAGG + Intronic
1001224073 5:169928585-169928607 CTGTCCTTTCCATGCTTTCTTGG - Intronic
1003528505 6:6918167-6918189 CTTGGCTTTCCATTGCTTGTGGG - Intergenic
1005075289 6:21901116-21901138 CAGGACTTTCCCTTCTCTGTTGG - Intergenic
1005325030 6:24691727-24691749 CTGTGCTTTCCATTGTTTGAGGG + Intronic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1007517721 6:42426539-42426561 ATGGAGTTTTCATTCTTTTTGGG - Intronic
1008948767 6:57131206-57131228 TTGGACAATCCATTCTTTATGGG + Intronic
1009456877 6:63867571-63867593 CTCGCTTTTGCATTCTTTGTAGG + Intronic
1010127873 6:72455039-72455061 CTGGAGTTTCCATTCTTGTTTGG - Intergenic
1012358099 6:98341268-98341290 TTGGACTGTGCATTCTTTGGAGG + Intergenic
1013833728 6:114307145-114307167 CTGCAGTTTCCAAACTTTGTAGG + Intronic
1014636191 6:123849571-123849593 CTGCACTTTCCTATCTCTGTGGG + Intronic
1015138525 6:129902329-129902351 CTGCACTTTCCACACTTTGTTGG + Intergenic
1016719115 6:147273021-147273043 ATGGACATTCCATTTTTTTTAGG + Intronic
1017278169 6:152594156-152594178 CTGGTCTTGCCATTCTGTGTGGG + Intronic
1017889867 6:158629128-158629150 ATGTGCTTTCCACTCTTTGTTGG + Intronic
1018732953 6:166666774-166666796 CTCTGCTTTCCATTCTTTTTGGG - Intronic
1020936731 7:14474140-14474162 CTTGAATTTCCATTTGTTGTGGG + Intronic
1021209078 7:17822899-17822921 CTGGGCTTTCAATTTTTTGTGGG + Intronic
1022468690 7:30668390-30668412 CTGAACGTTCCATTGTTTGGGGG + Intronic
1022556008 7:31297046-31297068 CTGGTCTTTCTGTTCTTTGAAGG + Intergenic
1023344048 7:39252957-39252979 CTGGAGCTTACATTCTTTGGGGG - Intronic
1023626906 7:42124588-42124610 CTTGGCTTTCCATACTTGGTTGG - Intronic
1023638181 7:42234410-42234432 TTGGACTTTCCTTTGTTTCTTGG - Intronic
1025029992 7:55549104-55549126 CTGGACTGCCCATTGTCTGTTGG - Intronic
1025872136 7:65444821-65444843 CTTGACTCTCCATTATTTGATGG + Intergenic
1031301165 7:120062444-120062466 CTGGACTTTCCTTTGTTGGGAGG + Intergenic
1032342894 7:131092195-131092217 CAGGTTTTTCCATTCTTAGTAGG - Intergenic
1032951236 7:136916101-136916123 CTGGACTATGCACTGTTTGTAGG + Intronic
1037558490 8:20050832-20050854 CTCTACATTCAATTCTTTGTGGG - Intergenic
1039430427 8:37521331-37521353 CTGGACTTTCCATTCAAGCTGGG + Intergenic
1039549868 8:38435606-38435628 CAGTACTTTCCATTCTCTTTTGG + Intronic
1040998966 8:53430927-53430949 CTGGACTCACCATCCTGTGTTGG + Intergenic
1042060719 8:64814211-64814233 CTGGACATTCTCTTCTTTGAGGG - Intergenic
1043202407 8:77386744-77386766 CTGGCATTTCCTTCCTTTGTGGG + Intergenic
1044588826 8:93893999-93894021 CTGGAATGTCCATACATTGTTGG + Intronic
1045367743 8:101492693-101492715 CTGGACTTTCAAGTCTGTGCAGG - Exonic
1045917626 8:107491342-107491364 ATGGAGTTTGCATTCTTAGTAGG + Intronic
1047167930 8:122461401-122461423 GTGGACTGTCCACTCATTGTAGG - Intergenic
1048964814 8:139607878-139607900 CTGGCCTTTTCATCTTTTGTAGG + Intronic
1050100290 9:2111891-2111913 GTGTACTTACCATTCTCTGTAGG + Intronic
1050111448 9:2220840-2220862 CAGGAATTCCCATTCATTGTCGG - Intergenic
1050797799 9:9566988-9567010 ATGGACTTTCCACACTTTGAGGG - Intronic
1051208988 9:14721979-14722001 CTGGCCTTTCCATTTTTTCTTGG - Intronic
1054786175 9:69212295-69212317 CTTAACATTCCATTCTTTTTAGG + Intronic
1057833020 9:98420938-98420960 CTCCGCTTTCCATTCTTTGTTGG - Intronic
1058115484 9:101079876-101079898 CTAGACTCTCCATTCTTTATAGG + Intronic
1058960589 9:109989290-109989312 CTTGCCTTGCCATTCATTGTTGG - Intronic
1061128464 9:128690654-128690676 CGTGACTTTCCAGTCTTTGTAGG + Intronic
1188019527 X:25142361-25142383 TTGGACTCTTCATTCTTTGTAGG + Intergenic
1188126433 X:26374505-26374527 CTGAACTTTCAATTCAGTGTGGG - Intergenic
1190783269 X:53619785-53619807 CTTGACTTTCCAAACTCTGTTGG - Intronic
1191789051 X:64949266-64949288 CTTGTCTTTCCCTTCTTTTTTGG - Intronic
1191990072 X:67025702-67025724 CTGTAATTTTCATTTTTTGTAGG + Intergenic
1192243854 X:69357567-69357589 GTGGACTATCCATACTCTGTGGG - Intergenic
1193095256 X:77541330-77541352 CTGGACTTCCTTTTGTTTGTGGG - Intronic
1193590075 X:83378371-83378393 CTGGTCTTTGACTTCTTTGTTGG + Intergenic
1194099898 X:89690744-89690766 CTGAAGTTTTCTTTCTTTGTCGG + Intergenic
1194245583 X:91507882-91507904 CAGGACTTTCCCTGGTTTGTAGG - Intergenic
1195505884 X:105656543-105656565 CTGGACAATACATTCTTTGGAGG - Intronic
1197193708 X:123677249-123677271 CTGCACACTCCATTCTTGGTGGG - Intronic
1197828155 X:130612832-130612854 CTGTGCTTGCCTTTCTTTGTTGG + Intergenic
1200452901 Y:3352108-3352130 CTGAAGTTTTCTTTCTTTGTCGG + Intergenic
1200562351 Y:4720640-4720662 CTGGACATTAAATTCTTGGTTGG + Intergenic
1200564551 Y:4749132-4749154 CAGGACTTTCCCTGGTTTGTAGG - Intergenic
1201411160 Y:13701016-13701038 CTTCCCTTTCCATTCTCTGTAGG + Intergenic
1202054549 Y:20815762-20815784 GTGGACTTTCCCATCTGTGTGGG - Intergenic
1202248712 Y:22846720-22846742 CTGTGCTTTCCATTTTTTGTTGG + Intergenic
1202401701 Y:24480468-24480490 CTGTGCTTTCCATTTTTTGTTGG + Intergenic
1202469080 Y:25189615-25189637 CTGTGCTTTCCATTTTTTGTTGG - Intergenic