ID: 1121765341

View in Genome Browser
Species Human (GRCh38)
Location 14:96481033-96481055
Sequence CCTACCACACAGGCCACAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 8, 3: 30, 4: 234}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121765341_1121765353 18 Left 1121765341 14:96481033-96481055 CCCTCTGTGGCCTGTGTGGTAGG 0: 1
1: 0
2: 8
3: 30
4: 234
Right 1121765353 14:96481074-96481096 CCAGAGTTACAATGCTACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 90
1121765341_1121765355 27 Left 1121765341 14:96481033-96481055 CCCTCTGTGGCCTGTGTGGTAGG 0: 1
1: 0
2: 8
3: 30
4: 234
Right 1121765355 14:96481083-96481105 CAATGCTACCCTGGGAGCCAAGG 0: 1
1: 0
2: 2
3: 10
4: 175
1121765341_1121765354 19 Left 1121765341 14:96481033-96481055 CCCTCTGTGGCCTGTGTGGTAGG 0: 1
1: 0
2: 8
3: 30
4: 234
Right 1121765354 14:96481075-96481097 CAGAGTTACAATGCTACCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121765341 Original CRISPR CCTACCACACAGGCCACAGA GGG (reversed) Intronic
900875334 1:5338483-5338505 CCTGCCCCACATGGCACAGACGG + Intergenic
901415542 1:9113584-9113606 CCTGCCACCGAGGCCACTGAGGG - Intronic
901528295 1:9837771-9837793 CCTTCCCCACAGCCCTCAGAAGG + Intergenic
902811306 1:18889516-18889538 CCTAACGCAGAGTCCACAGACGG + Intronic
903440702 1:23385925-23385947 AGGCCCACACAGGCCACAGATGG - Intronic
905307413 1:37029249-37029271 CCTACCACACTGGCCTCTGGAGG + Intronic
905313486 1:37066403-37066425 CCTACCACACTGGGCACACTGGG + Intergenic
908179670 1:61591450-61591472 CCTCCCTCACAGCCCGCAGAAGG - Intergenic
909844859 1:80380289-80380311 CTTCCCTCACAGGCCTCAGAAGG - Intergenic
910280401 1:85494455-85494477 CCTACCACCCAGGAGACAGCAGG + Intronic
910624182 1:89288952-89288974 GCTACCACCCAGGCCTGAGAAGG - Intergenic
914228379 1:145741737-145741759 TCTACCACAGAGGCCAAAAAGGG + Exonic
914456879 1:147844637-147844659 TCTCCCTCACAGCCCACAGAAGG + Intergenic
915941562 1:160121490-160121512 CCTATGACCCAGGCCCCAGAGGG + Intronic
919926250 1:202193328-202193350 CCTAGCAGACAGGCCAGGGAGGG + Intergenic
920199655 1:204251792-204251814 CCTTGCAGAAAGGCCACAGAAGG + Intronic
920843027 1:209570750-209570772 CCTCCCTCACAGCCCTCAGAAGG - Intergenic
923116462 1:230944129-230944151 CCTATCACAAATTCCACAGATGG + Intronic
924323333 1:242870903-242870925 CCTAGGACACAGGCCAGACAGGG - Intergenic
924815441 1:247437624-247437646 CCCACCACAGAGCCCCCAGAGGG - Intronic
1063375655 10:5552825-5552847 CCTACCTCCCAGACCAAAGAGGG - Intergenic
1066360638 10:34727101-34727123 CCCACCACACAGGGTGCAGAGGG - Intronic
1067272579 10:44805044-44805066 CTGACCACACTGGACACAGAAGG + Intergenic
1067553945 10:47254654-47254676 CCTACCCCAGGGACCACAGAAGG - Intergenic
1069862636 10:71481118-71481140 GCTGCCACCCAGGCCACAGCTGG - Intronic
1074205625 10:111280607-111280629 CCTATGACTCAGGGCACAGAAGG - Intergenic
1074477509 10:113785866-113785888 CCTGCAGAACAGGCCACAGAGGG + Intergenic
1074968646 10:118516758-118516780 CCTAACCCCCAGGCCACAGATGG - Intergenic
1075876298 10:125808803-125808825 TCCACCCCACAGTCCACAGATGG + Intronic
1076481159 10:130786066-130786088 CCTGCCGCACAAGCCAGAGATGG + Intergenic
1077006676 11:361231-361253 CCTTCCACACAGGCCAAAGAAGG - Intergenic
1077014559 11:393896-393918 CCTGACACTCAGGACACAGAGGG + Intronic
1077155269 11:1088262-1088284 GTTCCCACACAGGCCACACACGG - Intergenic
1077162838 11:1121477-1121499 CAAACCACAGAGGCCAAAGAGGG + Intergenic
1078451571 11:11444268-11444290 CCTGCCACAGAGGCACCAGAGGG + Intronic
1078467675 11:11562209-11562231 CCTTCCTCACAGCCCACAGAAGG - Intronic
1081788663 11:45767211-45767233 GATACCACAGAGGACACAGATGG + Intergenic
1082000916 11:47393363-47393385 CCCTGGACACAGGCCACAGAAGG - Intergenic
1082989667 11:59196571-59196593 CCCAACCCTCAGGCCACAGAAGG + Intronic
1083857492 11:65400370-65400392 CCTGCCTCCCAGGACACAGATGG - Intronic
1083890063 11:65591564-65591586 CCTCCCACACACCCCCCAGAAGG - Intronic
1084352747 11:68614987-68615009 CATACCACAGAGGCCACAGTGGG - Exonic
1084687302 11:70704050-70704072 CCCACGCCTCAGGCCACAGAGGG + Intronic
1085498234 11:76992550-76992572 CCTAGGACACAAGCCACAGTGGG - Intronic
1087709190 11:101530148-101530170 CCTACTTCCCAGGGCACAGATGG - Intronic
1088970393 11:114769796-114769818 CCAACCCGACAGGCCCCAGAGGG - Intergenic
1091223675 11:133945557-133945579 ACTGCCAAACAGGACACAGACGG + Intronic
1092833877 12:12469997-12470019 ACTTCCTCACACGCCACAGATGG - Intergenic
1094525805 12:31229804-31229826 CCTACCACACTGACTACAGCAGG + Intergenic
1098612236 12:72473078-72473100 CCCACCACACAGGCGTCACAAGG - Exonic
1098725802 12:73964837-73964859 CCTACCACAAAGTCTATAGAGGG - Intergenic
1099333448 12:81322125-81322147 CCAACCACACAGGCCAGTAATGG - Intronic
1100242056 12:92719855-92719877 CCTCACCCACTGGCCACAGAAGG + Intergenic
1100921860 12:99497479-99497501 CTTCCCTCACAGCCCACAGAAGG - Intronic
1101659420 12:106752783-106752805 TATTCCCCACAGGCCACAGAGGG - Intronic
1102709118 12:114909813-114909835 CCAACTACAAAGGGCACAGAGGG - Intergenic
1104150015 12:126073224-126073246 TCTACCACAAGGGACACAGAGGG - Intergenic
1104926296 12:132315757-132315779 CCTTCCACACAGAGCAGAGAGGG + Intronic
1105254996 13:18738511-18738533 GCTACGACCCAGGCCACAGGAGG + Intergenic
1105845402 13:24290033-24290055 CCTTCTGCACAGGCCACACAAGG - Intronic
1106099373 13:26681259-26681281 CCTCCCCCTCAGGCCCCAGAGGG + Exonic
1107441719 13:40433727-40433749 CCCAACCCTCAGGCCACAGATGG + Intergenic
1112622226 13:101064699-101064721 TCTCCCTCACAGGCCTCAGAAGG + Intronic
1113460418 13:110478581-110478603 CCCACCACACAGGCCAAGGCAGG + Intronic
1117249685 14:53924111-53924133 CATACCACAAAAGCCACAAAAGG + Intergenic
1118742791 14:68752588-68752610 CCTACTTCACAGCCCTCAGAAGG + Intergenic
1119883977 14:78124771-78124793 CCTACCACCCAGGCTACGGATGG + Intergenic
1120872156 14:89347437-89347459 CCTCCCTCACAGCCCACAGAAGG + Intronic
1121108476 14:91296135-91296157 CCCCCCAAACAGGCCACACATGG - Intronic
1121765341 14:96481033-96481055 CCTACCACACAGGCCACAGAGGG - Intronic
1121866492 14:97367149-97367171 CCCTCCACACAGGCTGCAGAAGG + Intergenic
1122117450 14:99534998-99535020 CCTTCCCCACAGCCCACAAAGGG + Intronic
1122266916 14:100550912-100550934 CCTGCCTCACAGGACACAGGTGG + Intronic
1122716181 14:103698310-103698332 CCCACCACTCAGGCCACAGTGGG - Exonic
1122982926 14:105199672-105199694 CCTAGGACTCAGGCAACAGAGGG - Intergenic
1123708276 15:22966464-22966486 CCAAGGAGACAGGCCACAGAGGG + Intronic
1123782861 15:23644905-23644927 CCAACCACTCAGGCCACGGGGGG + Exonic
1124179212 15:27457004-27457026 CCTACCACGCCGACCTCAGAAGG + Intronic
1128508866 15:68301452-68301474 CCGTCCACACTGGCCATAGATGG + Intronic
1129297114 15:74605588-74605610 CCTCCCTCACAGGCCTCAGGAGG + Intronic
1129499624 15:76023708-76023730 CATTCCACCCAGCCCACAGATGG + Intronic
1129861167 15:78862868-78862890 TCTTCCTCACAGTCCACAGAAGG + Intronic
1130000559 15:80043087-80043109 CCTGGCACCCAGGCCACAGTGGG + Intergenic
1132292365 15:100712544-100712566 TCTCCCACACAGCCCTCAGATGG - Intergenic
1132419101 15:101649999-101650021 CTTACAACACAGGTAACAGATGG + Exonic
1132835862 16:1953078-1953100 CCTCCCCCACAGGCCTCAGGAGG - Intronic
1133022321 16:2972214-2972236 CTAACCCCACAGGTCACAGAGGG - Exonic
1133026255 16:2990149-2990171 CCTCCCTCCCAGGCCTCAGACGG + Intergenic
1136170917 16:28488845-28488867 ACTAGACCACAGGCCACAGATGG + Intronic
1137009913 16:35311684-35311706 CCAATCACTCAGGCCACTGAGGG - Intergenic
1139522137 16:67489616-67489638 TCTACCCCAAAGGCCACAGCAGG - Intergenic
1140154793 16:72412929-72412951 CCCAACATCCAGGCCACAGATGG + Intergenic
1141476186 16:84275038-84275060 CCTTCCTCAGAGCCCACAGAGGG + Intergenic
1142232800 16:88907636-88907658 CCTTCCCCACTGGCCACAGAGGG + Intronic
1142900628 17:3009343-3009365 CCTTCCTCACAGGGCACTGAGGG - Intronic
1144219711 17:13089040-13089062 CCTCCCTCACAGTCCTCAGAAGG - Intergenic
1144352450 17:14410558-14410580 TCTACTACACAGGCTACAGTTGG - Intergenic
1144722701 17:17483352-17483374 CCCAACACAAAGCCCACAGAGGG + Intronic
1145040022 17:19570854-19570876 GGCACCACACAGGGCACAGAGGG - Intronic
1146279509 17:31536145-31536167 CCACACACACAGGACACAGAGGG - Exonic
1147326853 17:39673768-39673790 CCCACCAAACAGGCCACAGCTGG + Intronic
1149011315 17:51859554-51859576 CGTTTCACACAGGCCACTGAAGG + Intronic
1149444278 17:56701467-56701489 CCCACCCCACAGGCCACACGTGG + Intergenic
1150266332 17:63834541-63834563 CCCACCACCCAGGAGACAGATGG - Exonic
1152352403 17:79791075-79791097 CCTCCCACACCGGTCACAGCTGG + Intergenic
1152888318 17:82865461-82865483 CCTCCCACATAGCCCAGAGAGGG - Intronic
1155172814 18:23279682-23279704 CCTCCCTCACAGACCTCAGAAGG + Intronic
1155816711 18:30320495-30320517 TCTACCACAAAAGCCACATATGG - Intergenic
1158133852 18:54184180-54184202 CCCAACCCCCAGGCCACAGACGG + Intronic
1159008950 18:63040312-63040334 CCTTCCTCACAGTCCCCAGAAGG - Intergenic
1160236342 18:77089117-77089139 CATACTACAAAGGACACAGAGGG + Intronic
1160606794 18:80057697-80057719 CGTTCCTAACAGGCCACAGATGG - Intronic
1160835674 19:1123436-1123458 CCGCCCGCACAGCCCACAGAGGG - Intronic
1160943260 19:1629917-1629939 CCCACCCCACAGGCCACACCCGG + Intronic
1162795242 19:13083702-13083724 CAGGCCACACAGGCCACACAAGG - Intronic
1163041557 19:14606811-14606833 CCCACCACACATGCTACAGTGGG + Intronic
1163439641 19:17315590-17315612 CCCACCCCACAGGCTCCAGATGG - Intronic
1165538277 19:36468667-36468689 CCCACCACTCAGGCTCCAGAAGG - Intronic
1168329991 19:55562515-55562537 CCTCCCATACAGGCTTCAGACGG + Intergenic
925810703 2:7697494-7697516 CCTACCACACAAACCCCAGATGG + Intergenic
927218537 2:20684655-20684677 CAGGCCACACAAGCCACAGAGGG + Intronic
928220249 2:29397381-29397403 TCTTCCTCACAGGCCTCAGAAGG + Intronic
928433999 2:31241994-31242016 CCCGCCACACAGGGCACAGATGG - Intronic
928604864 2:32936274-32936296 CCTACCCCCCATGCCACTGATGG + Intergenic
929001331 2:37349964-37349986 TCTCCCACACAGGCCACACAGGG - Intronic
929238743 2:39631892-39631914 CAAACCACAGAGGCCACTGACGG - Intergenic
933559387 2:83873000-83873022 CTTACCTGACAGGCCACACAGGG + Intergenic
933802207 2:85970847-85970869 CCTAACCCACAGGCCGCAGACGG + Intergenic
934897171 2:98128955-98128977 CGTGCCACGCAGGCCACACAGGG - Intronic
935026815 2:99284950-99284972 CCTACCTCACAGGAGACTGACGG - Intronic
937428100 2:121816513-121816535 CCTGCCCCACCTGCCACAGAGGG - Intergenic
941395007 2:164963453-164963475 CCAACAACCCAGGACACAGAAGG - Intergenic
945493151 2:210479179-210479201 CCAACAAGACAGGCCTCAGATGG - Intronic
945831836 2:214796557-214796579 TCTCCCTCACAGCCCACAGAAGG + Intronic
945914021 2:215683485-215683507 TCTCCCTGACAGGCCACAGAAGG - Intergenic
945987009 2:216363030-216363052 CCCATCTCACAGGCCACAGCTGG + Intronic
946146184 2:217732905-217732927 CCCACCACACAGGCCAGCCATGG + Intronic
946870018 2:224076596-224076618 GCTTCTACACAGGCCACATAGGG + Intergenic
947544408 2:231000920-231000942 CCTATGACACAGGCCACTGAGGG - Intronic
948023015 2:234752557-234752579 TCTACCACTCAGCCCACAGTGGG - Intergenic
948225810 2:236308557-236308579 GCCCCCACACTGGCCACAGAGGG - Intergenic
948797667 2:240413041-240413063 CCCACCACACTGGCCAGAGAAGG + Intergenic
1169266691 20:4171488-4171510 CCCCCTACACAGCCCACAGAGGG - Intronic
1169439093 20:5619192-5619214 ACTACAACCCAGGCAACAGAGGG + Intergenic
1169871573 20:10253959-10253981 CCTCCCACAGAGCCCACAGATGG + Intronic
1170959888 20:21015940-21015962 CATACCACACAGGCCCAAGGAGG + Intergenic
1174327450 20:49790585-49790607 TCTACATCACAGGCCCCAGATGG - Intergenic
1174734342 20:52951038-52951060 CACACCACACAGACCACAGAAGG + Intergenic
1175806849 20:61834288-61834310 CCTAGGCCACAGGCCCCAGAAGG - Intronic
1175860163 20:62145933-62145955 ACTACCACGCAGGCTTCAGAGGG - Intronic
1176027150 20:62991740-62991762 GCTACCACTCAGGCCACTGCGGG - Intergenic
1178924724 21:36765172-36765194 CCTGGAACACAGGCCACAGTGGG + Exonic
1179471609 21:41614165-41614187 CCTGCCACACAGGAAACAGGTGG - Intergenic
1180593553 22:16959911-16959933 CCAACCACCCACTCCACAGATGG + Intergenic
1181004429 22:20005003-20005025 CCAAAAACACAGGCAACAGAAGG + Intronic
1182067667 22:27442107-27442129 CCTGCCACAGAGGCCCCAGTGGG - Intergenic
1182325719 22:29511286-29511308 CCTATCACACAGGCCATGGAGGG - Exonic
1182423545 22:30260140-30260162 CCCACCCCACAGGAAACAGATGG - Intergenic
1182519884 22:30879201-30879223 CCTGCCCCACAGGCCCCGGAGGG - Intronic
1182936214 22:34224063-34224085 CCTGCCACTCAGGAAACAGAGGG + Intergenic
1183581800 22:38730798-38730820 CCTCCCGCTCAGGCCACAGCCGG + Exonic
1184501626 22:44878200-44878222 ACTATCACACAGGCAACAGCTGG + Intergenic
1184901774 22:47450767-47450789 CCAACCACCCAGGCCACAGGTGG + Intergenic
1184928685 22:47663397-47663419 ACTACCACAAAGAACACAGAAGG - Intergenic
951445207 3:22771303-22771325 GCTACCACATAGGACACTGATGG - Intergenic
953659847 3:44883962-44883984 TTTACCTCACAGGCCACAGCGGG + Intronic
954385500 3:50241841-50241863 CCTACCTCTCAGGCCACCCAGGG - Intronic
954570409 3:51636446-51636468 CCTACCAGCCAGCCCTCAGATGG + Intronic
955521006 3:59775638-59775660 CCTCACATACAGGCCACATAAGG - Intronic
956669954 3:71678701-71678723 CCAACTGCACAGGGCACAGATGG + Exonic
957159035 3:76584582-76584604 CCTTCCCCACAGCCCTCAGAAGG + Intronic
958155808 3:89754144-89754166 TCAACCACACAGGAGACAGAGGG + Intergenic
959894817 3:111593953-111593975 CCTGCCACACAGGCGGCAGGTGG + Exonic
960704664 3:120470277-120470299 CCTCCCTCACAGCCCTCAGAAGG - Intergenic
960725497 3:120665865-120665887 CCTATCACACAGGCTTCAGCTGG + Intronic
963359984 3:144259432-144259454 CAAACCACACAGGCCTCTGAGGG + Intergenic
967120294 3:186376717-186376739 TCCTCCACATAGGCCACAGATGG - Intergenic
968468430 4:764804-764826 CCTACCTCACAGCCTAGAGATGG - Intronic
968658767 4:1790070-1790092 CCTGCCTCAAAGGCCCCAGAAGG + Intergenic
968836888 4:2971733-2971755 TCTTCCTCACAGCCCACAGAAGG - Intronic
969322458 4:6420941-6420963 CCTACCAGGCAGGCCTCAGAAGG + Intronic
970018091 4:11535134-11535156 TCTCCCACACAGCCTACAGAAGG + Intergenic
975551694 4:75619429-75619451 CAGAGCACACAGGCCAGAGATGG + Intronic
978365215 4:107974249-107974271 GCTACCACACAAGCCCAAGATGG - Intergenic
981401485 4:144319023-144319045 CATGCCACACAGGCCATAGCTGG - Intergenic
981405334 4:144360980-144361002 CCTCCCCCACAATCCACAGATGG - Intergenic
985571128 5:645890-645912 CCGTCCACACAGGCCGCCGACGG - Intronic
986000084 5:3623557-3623579 ACGACCACAGATGCCACAGAAGG - Intergenic
986735011 5:10662057-10662079 CCTGCCACACAGACCACAGGGGG + Intergenic
988112062 5:26834779-26834801 CCCAACCCCCAGGCCACAGATGG + Intergenic
988356237 5:30179335-30179357 CCTATCAAACCTGCCACAGATGG - Intergenic
990542988 5:56793238-56793260 CTCACCACACAGTCCTCAGACGG + Intergenic
990855779 5:60265222-60265244 CACCCCACACAGGCCACACAGGG + Intronic
992774810 5:80080045-80080067 CCTACAGCACAGGCCCCAGGTGG + Exonic
993751234 5:91670939-91670961 GCTATCACACCTGCCACAGAGGG + Intergenic
994049266 5:95344110-95344132 TCTCCCTCACAGGCCTCAGAAGG - Intergenic
994682112 5:102901219-102901241 CCTGCCACTCAGCCCTCAGAAGG + Intronic
999812288 5:155139269-155139291 ACAATCACACAGGCCACAGTAGG - Intergenic
1001056608 5:168455128-168455150 CCAACCACACGTGCCACGGAGGG + Intronic
1001136930 5:169110418-169110440 CCTCCCTCACAGCCCTCAGAAGG - Intronic
1001837160 5:174842144-174842166 TCTATCACACAGCCCAGAGAGGG - Intergenic
1002420595 5:179146225-179146247 CCAACCAAACAGGCAGCAGATGG + Intronic
1002830610 6:816903-816925 CACACCACACGGGCCACACAGGG - Intergenic
1003245413 6:4378359-4378381 CCTTCCACACAGGGCCCTGAAGG + Intergenic
1003334086 6:5154458-5154480 ACGATCACACAGGACACAGATGG + Intronic
1003679404 6:8237102-8237124 CAAAACTCACAGGCCACAGAGGG - Intergenic
1005462513 6:26082676-26082698 CCTTCCCCAGAGGCTACAGAGGG - Intergenic
1006692479 6:35901148-35901170 CCTCTAACACAGGCCTCAGAAGG - Intronic
1010057587 6:71584761-71584783 GCCACCACCCAGGCCCCAGAAGG - Intergenic
1010328075 6:74588108-74588130 GGTACCAGAAAGGCCACAGATGG + Intergenic
1013091906 6:106907812-106907834 CTTCCCTCACAGCCCACAGAAGG + Intergenic
1014222177 6:118808974-118808996 CTTAGGCCACAGGCCACAGAGGG - Intergenic
1014477447 6:121890735-121890757 CCTTCCTCACAGGAAACAGATGG - Intergenic
1014724331 6:124956507-124956529 CATACCACACATGCCACCAAGGG + Intergenic
1015589658 6:134810796-134810818 CCTTCCTCACAGCCCTCAGAAGG + Intergenic
1018146693 6:160898151-160898173 CCTCCCTCACAGCCCCCAGAAGG + Intergenic
1019323074 7:424442-424464 CCTACCCCAGGGGCCTCAGAAGG + Intergenic
1019705323 7:2494655-2494677 CCCACCACAGAGACCACGGAGGG - Intergenic
1019958074 7:4432899-4432921 CTTAACACACAGACCACAAAGGG + Intergenic
1021963506 7:25895150-25895172 CTTCCCACACAGGCTACACAGGG - Intergenic
1021978452 7:26031367-26031389 CCTCCCACAGAGGCTTCAGAGGG + Intergenic
1026299388 7:69083896-69083918 CCTCCCTCACAGCCCTCAGAAGG - Intergenic
1026576839 7:71578924-71578946 TGGACAACACAGGCCACAGAAGG - Intronic
1027677807 7:81181214-81181236 TCTACCATTCTGGCCACAGAAGG - Intronic
1029796162 7:102896612-102896634 CCTTCCTCACAGCCCTCAGAGGG - Intronic
1032690612 7:134283024-134283046 GCGACCCCACAGACCACAGAGGG + Intergenic
1033512888 7:142077990-142078012 CCTTCCAGACAAGACACAGAGGG + Intronic
1034374407 7:150629904-150629926 CCTACCCCAAAGGCCTCTGATGG + Intronic
1034485466 7:151358370-151358392 CCCACCCCACAGGCTGCAGATGG + Intronic
1034969756 7:155411485-155411507 CCTACCACTGAGGCCCCACAGGG + Intergenic
1035619190 8:1024554-1024576 CCCACCACAGAGGGCACAGCGGG - Intergenic
1037069559 8:14626753-14626775 CCTTCCTCACAGCCCTCAGAAGG + Intronic
1038346121 8:26734056-26734078 CACACCTCACAGGCCACTGAGGG - Intergenic
1039717621 8:40127324-40127346 CCTTCCTCACAGTCCTCAGAAGG - Intergenic
1040106169 8:43543319-43543341 CCTTCCACAGAGGCTGCAGAGGG + Intergenic
1041660100 8:60392950-60392972 CCTCCCTCACAGCCCCCAGAAGG + Intergenic
1045558354 8:103236760-103236782 CCTGCCACACAGGCCATCCAAGG - Intergenic
1050361919 9:4838276-4838298 CCTACCAGCCAGGGCCCAGAGGG + Intronic
1050886542 9:10773636-10773658 CCTACCTACCAGGCCACAGGAGG - Intergenic
1051563038 9:18464283-18464305 ACTACCACATATGACACAGAAGG - Intergenic
1055513439 9:77016310-77016332 CCCACCACCTAGGCCACAGCCGG - Intergenic
1057440130 9:95077124-95077146 CCTGCCACAAAGGACACAGAGGG - Intronic
1057442042 9:95090182-95090204 CCTACCACTCAGGGGACAGATGG - Intergenic
1058082764 9:100716914-100716936 CCTCCCTCACAGCCCTCAGAAGG - Intergenic
1058482717 9:105413431-105413453 CATTCCAGACAGGCCAGAGAAGG - Intronic
1059119198 9:111627002-111627024 CCTCCCTCAGAGGCCCCAGAAGG - Intergenic
1060160874 9:121361995-121362017 CCCAACTCCCAGGCCACAGACGG - Intronic
1060515687 9:124264268-124264290 CCCACCACACAGACTACAGCTGG - Intronic
1061495629 9:130972827-130972849 CCAGCCACACAGCCCACTGAGGG + Intergenic
1062053036 9:134457204-134457226 CCCACCCCACAGGACATAGAGGG - Intergenic
1062053056 9:134457278-134457300 CCCACCACACAGGACACAGAGGG - Intergenic
1062053077 9:134457352-134457374 CCCACCACACAGGACACAGAGGG - Intergenic
1062053097 9:134457426-134457448 CCCACCACACAGGACACAGATGG - Intergenic
1062053109 9:134457463-134457485 CCCACCCCACAGGACACAGATGG - Intergenic
1062053122 9:134457499-134457521 CCCACCCCACAGGACCCAGAGGG - Intergenic
1062053133 9:134457536-134457558 CCCACCACACAGGACACAGGGGG - Intergenic
1062053158 9:134457610-134457632 CCCACCCCACAGGACACAGAGGG - Intergenic
1062053168 9:134457647-134457669 CCCACCCCACAGGACACAGGGGG - Intergenic
1062053183 9:134457684-134457706 CCCACCCCACAGGACACAGAGGG - Intergenic
1188692644 X:33149463-33149485 GGTTCCTCACAGGCCACAGATGG + Intronic
1189010965 X:37045417-37045439 CCTGCCACACTGGCCAATGAGGG - Intergenic
1189269004 X:39737235-39737257 CCTACCCTAAAGGGCACAGATGG - Intergenic
1189711587 X:43818503-43818525 CCTTGCACACAGGCAACAGCAGG + Intronic
1192728502 X:73778205-73778227 CCTACCACCCAGGACATGGATGG + Intergenic
1195676594 X:107511647-107511669 CCTGCCAAACAGCCCCCAGAGGG + Intergenic
1198340723 X:135711080-135711102 CCTACCACACAAGCCACAAGTGG - Intergenic
1198347241 X:135770645-135770667 CCTACCACACAAGCCACAGGTGG + Intergenic
1198349147 X:135787907-135787929 CCTACCACACAAGCCACAGGTGG + Intergenic
1198351052 X:135805179-135805201 CCTACCACACAAGCCACAAGTGG + Intergenic
1198352959 X:135822444-135822466 CCTACCACACAAGCCACAGGTGG + Intergenic
1198354868 X:135839700-135839722 CCTACCACACAAGCCACAGGTGG + Intergenic
1198356778 X:135856982-135857004 CCTACCACACAAGCCACAAGTGG + Intergenic
1198358691 X:135874262-135874284 CCTACCACACAAGCCACAAGTGG + Intergenic