ID: 1121771387

View in Genome Browser
Species Human (GRCh38)
Location 14:96545429-96545451
Sequence GTCACCAATGCTAACGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121771387_1121771390 30 Left 1121771387 14:96545429-96545451 CCAGCAGCGTTAGCATTGGTGAC 0: 1
1: 0
2: 0
3: 7
4: 51
Right 1121771390 14:96545482-96545504 TGATCTGATTTTGATATGCTTGG 0: 1
1: 0
2: 0
3: 27
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121771387 Original CRISPR GTCACCAATGCTAACGCTGC TGG (reversed) Intronic
901271672 1:7956866-7956888 GTCACCAATGCTCCTGCTCCTGG - Intronic
909955607 1:81775260-81775282 GTCTCCAATGCTGAAGCAGCGGG + Intronic
912171395 1:107104454-107104476 ATCACCTATGCTAATGTTGCTGG - Intergenic
917644781 1:177019074-177019096 GTCCCCACTGCTCAAGCTGCAGG - Intronic
918842085 1:189554513-189554535 TTTACCAATGCTGACACTGCTGG - Intergenic
924656651 1:245978731-245978753 GTCAGCAATGCTACCTGTGCTGG + Intronic
1071719108 10:88124934-88124956 CTCACCAATGCTTACCCTTCTGG - Intergenic
1076572407 10:131441312-131441334 GTCACCCATACTAACCCAGCTGG + Intergenic
1078510600 11:11981593-11981615 ATCACCAATGCTTACGGGGCTGG + Intronic
1079535864 11:21514722-21514744 GTCATCTATGCTAAGGCTGTGGG + Intronic
1084294323 11:68201213-68201235 ATCACCAGTGCTACCGTTGCTGG + Intronic
1084793925 11:71491684-71491706 GTCACCAAGGCTTGCGGTGCTGG - Intronic
1091688984 12:2583099-2583121 CTCACCCATGCCAAAGCTGCAGG - Intronic
1096002048 12:48138268-48138290 GTTACTAATGCTAACGTTGAGGG + Intronic
1096111288 12:49030799-49030821 GACAGCGATGCAAACGCTGCAGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1111132198 13:83991886-83991908 TTTTCCAATGCTCACGCTGCAGG + Intergenic
1112586204 13:100721094-100721116 GCCGCCGATGCTAAGGCTGCTGG + Intergenic
1119262723 14:73247121-73247143 GGCACCATTGCTACCGCTCCCGG - Intronic
1121024754 14:90607342-90607364 CTCACGGATGCTAACACTGCAGG + Intronic
1121771387 14:96545429-96545451 GTCACCAATGCTAACGCTGCTGG - Intronic
1131251925 15:90836702-90836724 CTCACCAATGCCAACGAGGCAGG - Intergenic
1132615020 16:836102-836124 CTCACCACTGCAAACCCTGCAGG - Intergenic
1135014410 16:18912161-18912183 TTCACCAATGCTAAAACAGCGGG + Intronic
1136331573 16:29581470-29581492 TTCACCAATGCTAAGACAGCGGG + Intergenic
1145021697 17:19436627-19436649 GTCACCTATGCTAAAGTTCCAGG + Intergenic
1149551334 17:57542430-57542452 GTGACCAATGCTAAGGCTGTGGG - Intronic
1152089017 17:78236830-78236852 GTGACCAATACCAAGGCTGCTGG - Intronic
1153255441 18:3165819-3165841 ATCACCACTGCTACTGCTGCTGG + Intronic
1162546770 19:11335571-11335593 CTCACCACTGGTAACTCTGCAGG - Exonic
941854689 2:170219126-170219148 GTCTCAAATGCTAGCTCTGCTGG + Intronic
943225373 2:185167067-185167089 GTCACCACTACTACCACTGCAGG - Intergenic
1176232638 20:64039967-64039989 GTCAGAAGTGCTAACTCTGCAGG - Intronic
1176889697 21:14299598-14299620 GCCACCCCTGCTAACACTGCTGG - Intergenic
1179194809 21:39155178-39155200 GTCACCACTGCAAACGCTGTGGG - Intergenic
1183303143 22:37068400-37068422 GCCACCAACACTAACGCTGCAGG + Intronic
1183756430 22:39770543-39770565 GTCACCAGCCCTAACGCTGGAGG - Intronic
958118090 3:89248682-89248704 GTCACCAATGATGAAGCTGCAGG - Intronic
959138400 3:102454236-102454258 GTCAACAATACTCAAGCTGCAGG - Intronic
963200223 3:142578753-142578775 GTCTCCAAAGCTACCGCTGCCGG + Exonic
975812257 4:78181777-78181799 GTCAACCACGCCAACGCTGCGGG + Intronic
979014426 4:115414875-115414897 GTCACCCATGCTAAAGTTCCAGG - Intergenic
979806533 4:124979702-124979724 TACACCAATGCTGACACTGCTGG + Intergenic
982348410 4:154386665-154386687 GGCACCAGTGCTATGGCTGCTGG - Intronic
983027868 4:162759300-162759322 GTCACCATTGCTATTGCTGTTGG - Intergenic
988526445 5:31991289-31991311 GTCACCCAAGCTAAAGATGCTGG + Intronic
990856667 5:60274893-60274915 GTCACAGATGCTAATACTGCTGG - Intronic
1003733790 6:8854859-8854881 GACACCAATGCTTAAGCTGATGG + Intergenic
1005349400 6:24919343-24919365 GTCATTCATGCTAAGGCTGCTGG + Intronic
1008509374 6:52261928-52261950 GTCACCACTGCAATCTCTGCAGG + Intergenic
1010521123 6:76839016-76839038 ATCACCAATGCCAACGGTGTTGG + Intergenic
1010991615 6:82485750-82485772 TTCACCCATGCTAACACTGCAGG - Intergenic
1014292169 6:119571178-119571200 CTCACCAATGCTACCCCGGCAGG - Intergenic
1015371425 6:132458210-132458232 GTCACCAATGCAGATGCTACTGG + Exonic
1022139650 7:27482164-27482186 CTCCAAAATGCTAACGCTGCTGG - Intergenic
1024322664 7:48086396-48086418 GTCACCCATGCTAACGTTTCAGG + Intergenic
1039380513 8:37080598-37080620 GCCACATATGCTAAAGCTGCCGG + Intergenic
1195660666 X:107374697-107374719 GTCACCTATGCTGATGCTACTGG - Intergenic
1198546971 X:137702426-137702448 GTCACAGAGGCTAATGCTGCTGG - Intergenic