ID: 1121773147

View in Genome Browser
Species Human (GRCh38)
Location 14:96570276-96570298
Sequence GTATGTATGGGGATTGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121773147_1121773153 -4 Left 1121773147 14:96570276-96570298 CCCCTCTCAATCCCCATACATAC No data
Right 1121773153 14:96570295-96570317 ATACACACATATGTGAGTTTTGG No data
1121773147_1121773156 15 Left 1121773147 14:96570276-96570298 CCCCTCTCAATCCCCATACATAC No data
Right 1121773156 14:96570314-96570336 TTGGGGTTCTTTTCAGTTTTAGG No data
1121773147_1121773155 -2 Left 1121773147 14:96570276-96570298 CCCCTCTCAATCCCCATACATAC No data
Right 1121773155 14:96570297-96570319 ACACACATATGTGAGTTTTGGGG No data
1121773147_1121773154 -3 Left 1121773147 14:96570276-96570298 CCCCTCTCAATCCCCATACATAC No data
Right 1121773154 14:96570296-96570318 TACACACATATGTGAGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121773147 Original CRISPR GTATGTATGGGGATTGAGAG GGG (reversed) Intergenic
No off target data available for this crispr