ID: 1121778522

View in Genome Browser
Species Human (GRCh38)
Location 14:96606832-96606854
Sequence CAAGGAGACCACATCCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121778522_1121778528 3 Left 1121778522 14:96606832-96606854 CCCATGTGGATGTGGTCTCCTTG No data
Right 1121778528 14:96606858-96606880 ATGCGTTCTGCTTCCCCGGCTGG No data
1121778522_1121778534 25 Left 1121778522 14:96606832-96606854 CCCATGTGGATGTGGTCTCCTTG No data
Right 1121778534 14:96606880-96606902 GAGCCAGTAGCGTAAGGTGGAGG No data
1121778522_1121778527 -1 Left 1121778522 14:96606832-96606854 CCCATGTGGATGTGGTCTCCTTG No data
Right 1121778527 14:96606854-96606876 GGGAATGCGTTCTGCTTCCCCGG No data
1121778522_1121778532 19 Left 1121778522 14:96606832-96606854 CCCATGTGGATGTGGTCTCCTTG No data
Right 1121778532 14:96606874-96606896 CGGCTGGAGCCAGTAGCGTAAGG No data
1121778522_1121778533 22 Left 1121778522 14:96606832-96606854 CCCATGTGGATGTGGTCTCCTTG No data
Right 1121778533 14:96606877-96606899 CTGGAGCCAGTAGCGTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121778522 Original CRISPR CAAGGAGACCACATCCACAT GGG (reversed) Intergenic
No off target data available for this crispr