ID: 1121779555

View in Genome Browser
Species Human (GRCh38)
Location 14:96613636-96613658
Sequence TGGCATGTGCAGGATCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121779551_1121779555 -4 Left 1121779551 14:96613617-96613639 CCATGGGTGGCCAGCAGCCTGGC No data
Right 1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG No data
1121779544_1121779555 21 Left 1121779544 14:96613592-96613614 CCCTATCACTGAGAAGTCAAGGT No data
Right 1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG No data
1121779545_1121779555 20 Left 1121779545 14:96613593-96613615 CCTATCACTGAGAAGTCAAGGTG No data
Right 1121779555 14:96613636-96613658 TGGCATGTGCAGGATCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121779555 Original CRISPR TGGCATGTGCAGGATCTGAG AGG Intergenic
No off target data available for this crispr