ID: 1121779871

View in Genome Browser
Species Human (GRCh38)
Location 14:96615493-96615515
Sequence CGTTAATACTGTGTTCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121779871_1121779876 26 Left 1121779871 14:96615493-96615515 CCGAGAGGAACACAGTATTAACG No data
Right 1121779876 14:96615542-96615564 AACGACTCTCCTGCCAGCCACGG No data
1121779871_1121779877 27 Left 1121779871 14:96615493-96615515 CCGAGAGGAACACAGTATTAACG No data
Right 1121779877 14:96615543-96615565 ACGACTCTCCTGCCAGCCACGGG No data
1121779871_1121779878 28 Left 1121779871 14:96615493-96615515 CCGAGAGGAACACAGTATTAACG No data
Right 1121779878 14:96615544-96615566 CGACTCTCCTGCCAGCCACGGGG 0: 1
1: 0
2: 0
3: 15
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121779871 Original CRISPR CGTTAATACTGTGTTCCTCT CGG (reversed) Intergenic