ID: 1121779878

View in Genome Browser
Species Human (GRCh38)
Location 14:96615544-96615566
Sequence CGACTCTCCTGCCAGCCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121779871_1121779878 28 Left 1121779871 14:96615493-96615515 CCGAGAGGAACACAGTATTAACG No data
Right 1121779878 14:96615544-96615566 CGACTCTCCTGCCAGCCACGGGG No data
1121779870_1121779878 29 Left 1121779870 14:96615492-96615514 CCCGAGAGGAACACAGTATTAAC No data
Right 1121779878 14:96615544-96615566 CGACTCTCCTGCCAGCCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121779878 Original CRISPR CGACTCTCCTGCCAGCCACG GGG Intergenic
No off target data available for this crispr