ID: 1121779878

View in Genome Browser
Species Human (GRCh38)
Location 14:96615544-96615566
Sequence CGACTCTCCTGCCAGCCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121779871_1121779878 28 Left 1121779871 14:96615493-96615515 CCGAGAGGAACACAGTATTAACG No data
Right 1121779878 14:96615544-96615566 CGACTCTCCTGCCAGCCACGGGG 0: 1
1: 0
2: 0
3: 15
4: 121
1121779870_1121779878 29 Left 1121779870 14:96615492-96615514 CCCGAGAGGAACACAGTATTAAC 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1121779878 14:96615544-96615566 CGACTCTCCTGCCAGCCACGGGG 0: 1
1: 0
2: 0
3: 15
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121779878 Original CRISPR CGACTCTCCTGCCAGCCACG GGG Intergenic