ID: 1121782342

View in Genome Browser
Species Human (GRCh38)
Location 14:96629995-96630017
Sequence GCTGCTCTTGAACAGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121782332_1121782342 29 Left 1121782332 14:96629943-96629965 CCTGCAGGGCTAGGAGTGAGGAT No data
Right 1121782342 14:96629995-96630017 GCTGCTCTTGAACAGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121782342 Original CRISPR GCTGCTCTTGAACAGGAGTG AGG Intergenic
No off target data available for this crispr