ID: 1121784734

View in Genome Browser
Species Human (GRCh38)
Location 14:96649077-96649099
Sequence CAGCAGTAGCAGATGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121784729_1121784734 -2 Left 1121784729 14:96649056-96649078 CCGGGAAAAGTGCACAGATGCCA No data
Right 1121784734 14:96649077-96649099 CAGCAGTAGCAGATGGGGAAAGG No data
1121784727_1121784734 8 Left 1121784727 14:96649046-96649068 CCTCAAGCCTCCGGGAAAAGTGC No data
Right 1121784734 14:96649077-96649099 CAGCAGTAGCAGATGGGGAAAGG No data
1121784726_1121784734 13 Left 1121784726 14:96649041-96649063 CCAGTCCTCAAGCCTCCGGGAAA No data
Right 1121784734 14:96649077-96649099 CAGCAGTAGCAGATGGGGAAAGG No data
1121784728_1121784734 1 Left 1121784728 14:96649053-96649075 CCTCCGGGAAAAGTGCACAGATG No data
Right 1121784734 14:96649077-96649099 CAGCAGTAGCAGATGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121784734 Original CRISPR CAGCAGTAGCAGATGGGGAA AGG Intergenic
No off target data available for this crispr