ID: 1121786198

View in Genome Browser
Species Human (GRCh38)
Location 14:96663083-96663105
Sequence CTCCGCGGGAATCCGGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121786198_1121786209 26 Left 1121786198 14:96663083-96663105 CCGTGGCCCGGATTCCCGCGGAG No data
Right 1121786209 14:96663132-96663154 ACCATGAAAAAGGCCCACTCTGG No data
1121786198_1121786206 16 Left 1121786198 14:96663083-96663105 CCGTGGCCCGGATTCCCGCGGAG No data
Right 1121786206 14:96663122-96663144 ACCACCAGTGACCATGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121786198 Original CRISPR CTCCGCGGGAATCCGGGCCA CGG (reversed) Intergenic
No off target data available for this crispr