ID: 1121787084

View in Genome Browser
Species Human (GRCh38)
Location 14:96670228-96670250
Sequence CTGGGGAGACAGACCTGACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121787074_1121787084 16 Left 1121787074 14:96670189-96670211 CCAAATCCCTGTGATCTCGTTTT No data
Right 1121787084 14:96670228-96670250 CTGGGGAGACAGACCTGACCCGG No data
1121787073_1121787084 17 Left 1121787073 14:96670188-96670210 CCCAAATCCCTGTGATCTCGTTT No data
Right 1121787084 14:96670228-96670250 CTGGGGAGACAGACCTGACCCGG No data
1121787076_1121787084 9 Left 1121787076 14:96670196-96670218 CCTGTGATCTCGTTTTCCAACAG No data
Right 1121787084 14:96670228-96670250 CTGGGGAGACAGACCTGACCCGG No data
1121787075_1121787084 10 Left 1121787075 14:96670195-96670217 CCCTGTGATCTCGTTTTCCAACA No data
Right 1121787084 14:96670228-96670250 CTGGGGAGACAGACCTGACCCGG No data
1121787080_1121787084 -7 Left 1121787080 14:96670212-96670234 CCAACAGCCCAGCTGCCTGGGGA No data
Right 1121787084 14:96670228-96670250 CTGGGGAGACAGACCTGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121787084 Original CRISPR CTGGGGAGACAGACCTGACC CGG Intergenic
No off target data available for this crispr