ID: 1121792952

View in Genome Browser
Species Human (GRCh38)
Location 14:96712559-96712581
Sequence CCCTTTGATAGCGGCATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121792952_1121792958 4 Left 1121792952 14:96712559-96712581 CCACTCATGCCGCTATCAAAGGG No data
Right 1121792958 14:96712586-96712608 GAGAACTGAGATTAAACTAGGGG No data
1121792952_1121792964 23 Left 1121792952 14:96712559-96712581 CCACTCATGCCGCTATCAAAGGG No data
Right 1121792964 14:96712605-96712627 GGGGAGGAGGCCGGGCATGGTGG No data
1121792952_1121792956 2 Left 1121792952 14:96712559-96712581 CCACTCATGCCGCTATCAAAGGG No data
Right 1121792956 14:96712584-96712606 GAGAGAACTGAGATTAAACTAGG No data
1121792952_1121792959 7 Left 1121792952 14:96712559-96712581 CCACTCATGCCGCTATCAAAGGG No data
Right 1121792959 14:96712589-96712611 AACTGAGATTAAACTAGGGGAGG No data
1121792952_1121792960 10 Left 1121792952 14:96712559-96712581 CCACTCATGCCGCTATCAAAGGG No data
Right 1121792960 14:96712592-96712614 TGAGATTAAACTAGGGGAGGAGG No data
1121792952_1121792962 15 Left 1121792952 14:96712559-96712581 CCACTCATGCCGCTATCAAAGGG No data
Right 1121792962 14:96712597-96712619 TTAAACTAGGGGAGGAGGCCGGG No data
1121792952_1121792963 20 Left 1121792952 14:96712559-96712581 CCACTCATGCCGCTATCAAAGGG No data
Right 1121792963 14:96712602-96712624 CTAGGGGAGGAGGCCGGGCATGG No data
1121792952_1121792961 14 Left 1121792952 14:96712559-96712581 CCACTCATGCCGCTATCAAAGGG No data
Right 1121792961 14:96712596-96712618 ATTAAACTAGGGGAGGAGGCCGG No data
1121792952_1121792957 3 Left 1121792952 14:96712559-96712581 CCACTCATGCCGCTATCAAAGGG No data
Right 1121792957 14:96712585-96712607 AGAGAACTGAGATTAAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121792952 Original CRISPR CCCTTTGATAGCGGCATGAG TGG (reversed) Intergenic
No off target data available for this crispr