ID: 1121796638

View in Genome Browser
Species Human (GRCh38)
Location 14:96741506-96741528
Sequence CGGGTGTCGGCACCAGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121796638_1121796647 26 Left 1121796638 14:96741506-96741528 CCCACTGCTGGTGCCGACACCCG No data
Right 1121796647 14:96741555-96741577 CCCGCCGCTCCTCGCAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121796638 Original CRISPR CGGGTGTCGGCACCAGCAGT GGG (reversed) Intergenic
No off target data available for this crispr