ID: 1121796749

View in Genome Browser
Species Human (GRCh38)
Location 14:96741908-96741930
Sequence CGGCGGGGCTGCCTTTCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121796737_1121796749 4 Left 1121796737 14:96741881-96741903 CCCAAGCCCGGACCCTTGGAAGT No data
Right 1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG No data
1121796733_1121796749 25 Left 1121796733 14:96741860-96741882 CCCTGGGCATGGGGCGAGTGGCC No data
Right 1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG No data
1121796747_1121796749 -9 Left 1121796747 14:96741894-96741916 CCTTGGAAGTGGCGCGGCGGGGC No data
Right 1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG No data
1121796734_1121796749 24 Left 1121796734 14:96741861-96741883 CCTGGGCATGGGGCGAGTGGCCC No data
Right 1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG No data
1121796738_1121796749 3 Left 1121796738 14:96741882-96741904 CCAAGCCCGGACCCTTGGAAGTG No data
Right 1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG No data
1121796745_1121796749 -8 Left 1121796745 14:96741893-96741915 CCCTTGGAAGTGGCGCGGCGGGG No data
Right 1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG No data
1121796740_1121796749 -2 Left 1121796740 14:96741887-96741909 CCCGGACCCTTGGAAGTGGCGCG No data
Right 1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG No data
1121796741_1121796749 -3 Left 1121796741 14:96741888-96741910 CCGGACCCTTGGAAGTGGCGCGG No data
Right 1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG No data
1121796731_1121796749 30 Left 1121796731 14:96741855-96741877 CCGAACCCTGGGCATGGGGCGAG No data
Right 1121796749 14:96741908-96741930 CGGCGGGGCTGCCTTTCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121796749 Original CRISPR CGGCGGGGCTGCCTTTCCTC GGG Intergenic