ID: 1121800646

View in Genome Browser
Species Human (GRCh38)
Location 14:96771267-96771289
Sequence AACCTTTGCCTACCATTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121800642_1121800646 24 Left 1121800642 14:96771220-96771242 CCAAAAAACAGAAGTGAACAGTG No data
Right 1121800646 14:96771267-96771289 AACCTTTGCCTACCATTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121800646 Original CRISPR AACCTTTGCCTACCATTGGT AGG Intergenic
No off target data available for this crispr