ID: 1121801388

View in Genome Browser
Species Human (GRCh38)
Location 14:96777188-96777210
Sequence CCCAAGCTAGCCACATGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121801388_1121801394 8 Left 1121801388 14:96777188-96777210 CCTCTCCATGTGGCTAGCTTGGG No data
Right 1121801394 14:96777219-96777241 AGAGCAGCATGGTCTTTCCTAGG No data
1121801388_1121801396 10 Left 1121801388 14:96777188-96777210 CCTCTCCATGTGGCTAGCTTGGG No data
Right 1121801396 14:96777221-96777243 AGCAGCATGGTCTTTCCTAGGGG No data
1121801388_1121801395 9 Left 1121801388 14:96777188-96777210 CCTCTCCATGTGGCTAGCTTGGG No data
Right 1121801395 14:96777220-96777242 GAGCAGCATGGTCTTTCCTAGGG No data
1121801388_1121801398 16 Left 1121801388 14:96777188-96777210 CCTCTCCATGTGGCTAGCTTGGG No data
Right 1121801398 14:96777227-96777249 ATGGTCTTTCCTAGGGGGATTGG No data
1121801388_1121801391 -3 Left 1121801388 14:96777188-96777210 CCTCTCCATGTGGCTAGCTTGGG No data
Right 1121801391 14:96777208-96777230 GGGCTACCCTTAGAGCAGCATGG No data
1121801388_1121801397 11 Left 1121801388 14:96777188-96777210 CCTCTCCATGTGGCTAGCTTGGG No data
Right 1121801397 14:96777222-96777244 GCAGCATGGTCTTTCCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121801388 Original CRISPR CCCAAGCTAGCCACATGGAG AGG (reversed) Intergenic
No off target data available for this crispr