ID: 1121801390

View in Genome Browser
Species Human (GRCh38)
Location 14:96777193-96777215
Sequence GGTAGCCCAAGCTAGCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121801390_1121801395 4 Left 1121801390 14:96777193-96777215 CCATGTGGCTAGCTTGGGCTACC No data
Right 1121801395 14:96777220-96777242 GAGCAGCATGGTCTTTCCTAGGG No data
1121801390_1121801394 3 Left 1121801390 14:96777193-96777215 CCATGTGGCTAGCTTGGGCTACC No data
Right 1121801394 14:96777219-96777241 AGAGCAGCATGGTCTTTCCTAGG No data
1121801390_1121801397 6 Left 1121801390 14:96777193-96777215 CCATGTGGCTAGCTTGGGCTACC No data
Right 1121801397 14:96777222-96777244 GCAGCATGGTCTTTCCTAGGGGG No data
1121801390_1121801396 5 Left 1121801390 14:96777193-96777215 CCATGTGGCTAGCTTGGGCTACC No data
Right 1121801396 14:96777221-96777243 AGCAGCATGGTCTTTCCTAGGGG No data
1121801390_1121801398 11 Left 1121801390 14:96777193-96777215 CCATGTGGCTAGCTTGGGCTACC No data
Right 1121801398 14:96777227-96777249 ATGGTCTTTCCTAGGGGGATTGG No data
1121801390_1121801391 -8 Left 1121801390 14:96777193-96777215 CCATGTGGCTAGCTTGGGCTACC No data
Right 1121801391 14:96777208-96777230 GGGCTACCCTTAGAGCAGCATGG No data
1121801390_1121801400 30 Left 1121801390 14:96777193-96777215 CCATGTGGCTAGCTTGGGCTACC No data
Right 1121801400 14:96777246-96777268 TTGGACAGCTGACTCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121801390 Original CRISPR GGTAGCCCAAGCTAGCCACA TGG (reversed) Intergenic