ID: 1121801394

View in Genome Browser
Species Human (GRCh38)
Location 14:96777219-96777241
Sequence AGAGCAGCATGGTCTTTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121801390_1121801394 3 Left 1121801390 14:96777193-96777215 CCATGTGGCTAGCTTGGGCTACC No data
Right 1121801394 14:96777219-96777241 AGAGCAGCATGGTCTTTCCTAGG No data
1121801388_1121801394 8 Left 1121801388 14:96777188-96777210 CCTCTCCATGTGGCTAGCTTGGG No data
Right 1121801394 14:96777219-96777241 AGAGCAGCATGGTCTTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121801394 Original CRISPR AGAGCAGCATGGTCTTTCCT AGG Intergenic