ID: 1121801397 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:96777222-96777244 |
Sequence | GCAGCATGGTCTTTCCTAGG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1121801388_1121801397 | 11 | Left | 1121801388 | 14:96777188-96777210 | CCTCTCCATGTGGCTAGCTTGGG | No data | ||
Right | 1121801397 | 14:96777222-96777244 | GCAGCATGGTCTTTCCTAGGGGG | No data | ||||
1121801390_1121801397 | 6 | Left | 1121801390 | 14:96777193-96777215 | CCATGTGGCTAGCTTGGGCTACC | No data | ||
Right | 1121801397 | 14:96777222-96777244 | GCAGCATGGTCTTTCCTAGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1121801397 | Original CRISPR | GCAGCATGGTCTTTCCTAGG GGG | Intergenic | ||