ID: 1121801400

View in Genome Browser
Species Human (GRCh38)
Location 14:96777246-96777268
Sequence TTGGACAGCTGACTCTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121801393_1121801400 8 Left 1121801393 14:96777215-96777237 CCTTAGAGCAGCATGGTCTTTCC No data
Right 1121801400 14:96777246-96777268 TTGGACAGCTGACTCTCTCTAGG No data
1121801390_1121801400 30 Left 1121801390 14:96777193-96777215 CCATGTGGCTAGCTTGGGCTACC No data
Right 1121801400 14:96777246-96777268 TTGGACAGCTGACTCTCTCTAGG No data
1121801392_1121801400 9 Left 1121801392 14:96777214-96777236 CCCTTAGAGCAGCATGGTCTTTC No data
Right 1121801400 14:96777246-96777268 TTGGACAGCTGACTCTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121801400 Original CRISPR TTGGACAGCTGACTCTCTCT AGG Intergenic