ID: 1121812205

View in Genome Browser
Species Human (GRCh38)
Location 14:96901104-96901126
Sequence TGCTATGGGGATTTAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121812205 Original CRISPR TGCTATGGGGATTTAGAGGA AGG (reversed) Intronic
900826716 1:4932909-4932931 TTCTATGTGGACTGAGAGGAAGG - Intergenic
901775558 1:11558469-11558491 GGCTAGGGGGTTTTGGAGGAAGG - Intergenic
902829992 1:19006195-19006217 TGCTATGGAAATGCAGAGGAAGG - Intergenic
903116319 1:21181332-21181354 TGCCAAGGGGATCTAGAGGAAGG - Intergenic
903209932 1:21812226-21812248 TGCCATGGAGATTTGGAGCAAGG - Intergenic
903764493 1:25725397-25725419 TGCTACGGGAATACAGAGGAAGG + Intronic
904558870 1:31383641-31383663 AGCCATGGGGATTGAGAGAATGG - Intergenic
904771141 1:32882105-32882127 TGCTGTGAGGATTAAGAGGGAGG - Intergenic
905149295 1:35914547-35914569 TGCTTTTGGGATGTAGGGGAGGG + Intronic
905297243 1:36961984-36962006 TGCTCTGGGGATGCAGATGAAGG + Intronic
905394477 1:37658109-37658131 TGCTACGGGGATGTCAAGGAGGG + Intergenic
905540617 1:38757527-38757549 TGCTATGGGAAAGCAGAGGAGGG - Intergenic
906343674 1:45002296-45002318 GGATATGGTGATTTGGAGGATGG - Intergenic
907564564 1:55422767-55422789 TGCTTTGGGGAATTAGGGGCAGG + Intergenic
908826784 1:68140990-68141012 AGATTTGGGGATTTTGAGGAGGG - Intronic
909538564 1:76765918-76765940 TATGTTGGGGATTTAGAGGATGG - Intergenic
909561720 1:77015651-77015673 TGCTTTGGGGGTTCAGAGGAGGG + Intronic
910283199 1:85524286-85524308 TGCTGTGGGAGTTGAGAGGATGG + Intronic
910813973 1:91269634-91269656 TGCAATGGGAATGCAGAGGAAGG + Intronic
911209451 1:95124013-95124035 TGTTATGGGGATTTCAAGGTGGG + Intronic
911899863 1:103489019-103489041 TGCTTAGGGGATTTGGAGGAGGG + Intergenic
912146681 1:106802810-106802832 GGCTATGGTGAATTTGAGGATGG + Intergenic
912372528 1:109185029-109185051 TGCTTTGGCAATTTAGAGAAAGG + Exonic
913267412 1:117059006-117059028 TGTTATGGGGATCCGGAGGAAGG - Intergenic
914206813 1:145538696-145538718 TGCTGTGGGAGTTGAGAGGATGG - Intergenic
915516937 1:156418965-156418987 TCCTTTAGAGATTTAGAGGAAGG - Intronic
915956103 1:160221273-160221295 TGCAATAGGCATTTAGAGAAAGG - Intronic
916562210 1:165942774-165942796 TGCTATGGGGGTTGAGAAGAAGG + Intergenic
918987875 1:191657048-191657070 TGCTAAGGTAGTTTAGAGGAAGG - Intergenic
919301257 1:195769584-195769606 TAGTATTGGAATTTAGAGGAGGG - Intergenic
919503369 1:198366743-198366765 TGCCATTTGGATTTAGGGGATGG + Intergenic
919575911 1:199309358-199309380 TGCTATGGAAAGTCAGAGGAAGG - Intergenic
920444593 1:206006303-206006325 GGTTGTGGGGATTTAGAGGAAGG + Intergenic
921257254 1:213353831-213353853 TGTTATGGAAATTCAGAGGAAGG + Intergenic
921723258 1:218496766-218496788 TGTTCTGGGCATTTAGGGGAGGG + Intergenic
923348217 1:233078524-233078546 TGCTATAGTGATTTAGAACAGGG + Intronic
923550547 1:234959612-234959634 GCCCATGGGGATTTGGAGGACGG - Intergenic
924023693 1:239811128-239811150 TGCTATTGGGATTTTGAGTCAGG - Intronic
924668943 1:246103539-246103561 GGCTCTGGGAATTTAGAGGAGGG - Intronic
1065386385 10:25137772-25137794 TGCTAGGAGAATTCAGAGGAGGG - Intergenic
1066129169 10:32373612-32373634 TGCTATGGGGCTTCTGAGAAAGG + Intronic
1067362101 10:45591956-45591978 TGCTATGGAAATTGAGAGGAAGG - Intronic
1068214296 10:53963741-53963763 GGCTATGGGGCTTAAGAGAAAGG - Intronic
1069692378 10:70362532-70362554 TGCAATGGGGAGTTAGAGTGAGG + Intronic
1071413444 10:85419452-85419474 TGTTACTGGGATTTAGAAGAAGG - Intergenic
1072859858 10:98991981-98992003 TGCTATATGGCTTTAGAGAAAGG - Intronic
1073366864 10:102950094-102950116 TGCTATGGGCACCCAGAGGAAGG + Intronic
1074338349 10:112601059-112601081 TTTTATGGGGATTCAGAGAAGGG + Intronic
1074414060 10:113251675-113251697 TGCCATGGGAACTCAGAGGAAGG + Intergenic
1074727004 10:116321409-116321431 TGCTATGGGAATATAGGAGAGGG - Intergenic
1074927558 10:118088755-118088777 TGCTTTGGAGATTCAGAGAAGGG - Intergenic
1075155318 10:119971420-119971442 TGCTCTGAGGGTTTAGAGGAGGG + Intergenic
1076204450 10:128585599-128585621 TGCAAAGGGAATTTAAAGGATGG - Intergenic
1076691955 10:132228319-132228341 TGCTCTGGGGATTAAGATGTGGG + Intronic
1077663230 11:4087315-4087337 TGCTATGGGGGTGTTGAGGAAGG + Intronic
1077862364 11:6194455-6194477 TGCTATGTGAATTCAGAGGGAGG + Intergenic
1078539889 11:12204871-12204893 TGCTAAAGGAATTTGGAGGAAGG + Intronic
1079015922 11:16868621-16868643 TGCTATAGGCATTGAGAAGAAGG - Intronic
1079019377 11:16896528-16896550 GGCTGTGGGGATGGAGAGGATGG - Intronic
1082837525 11:57662375-57662397 TACTGTGGGGAGTTAGAGGCTGG + Intergenic
1083194468 11:61076174-61076196 GGCTGTGGGGAGTTAGAGGTAGG + Intergenic
1083231252 11:61321666-61321688 TGCTCTGGGGCTTTCAAGGAAGG - Exonic
1083796588 11:65020344-65020366 TGCTCTGGGCCATTAGAGGAGGG + Intronic
1084901252 11:72311574-72311596 TACTATGGGAGCTTAGAGGAAGG + Intronic
1085262540 11:75215810-75215832 TGCATTGGAGATTTGGAGGAGGG - Intergenic
1085553269 11:77395207-77395229 TGCTTTGGGAATATGGAGGAGGG - Intronic
1085724127 11:78939614-78939636 TGCTATGGGAACATAGAGAATGG - Intronic
1085999566 11:81965136-81965158 TGCTGTGATGATTTAGGGGAGGG - Intergenic
1086282947 11:85212017-85212039 TGCAATGGGAATTTTGATGAGGG - Intronic
1087130632 11:94666655-94666677 AGCTATGGGAACTTAGAGAAGGG - Intergenic
1087245622 11:95833006-95833028 TGCTATGGGGGCACAGAGGAAGG + Exonic
1088564382 11:111152469-111152491 TGCTATGGGACTCTAGAGGAGGG + Intergenic
1088714996 11:112541317-112541339 GGCTATGGGGACCTAGAAGATGG + Intergenic
1089721577 11:120428714-120428736 TTCTATGAGGATTCAAAGGAGGG + Intronic
1089892466 11:121895095-121895117 TGCTGTGGGAATTTAGAGAAGGG + Intergenic
1090023428 11:123147597-123147619 TGCTATGGGAATCCAGAGTAGGG - Intronic
1090469720 11:126969402-126969424 TGCTATGGGAACTCAGAGGAGGG + Intronic
1092358910 12:7819744-7819766 GGCTATGGGGATTTTGAGCCAGG - Intronic
1092372030 12:7924672-7924694 GGCTATGGGGATTTTGAGCCAGG - Intronic
1093550280 12:20401689-20401711 CGCTATGGAGACTCAGAGGAAGG - Intronic
1093609734 12:21138860-21138882 TGCTATGGGTATATTGAGAATGG + Intronic
1096000358 12:48124724-48124746 TGTTATGGGGATTTGCAGGTGGG - Intronic
1097158965 12:57032145-57032167 TGCTATGGGGCTTCAAAGAAAGG - Intronic
1098335636 12:69401861-69401883 TGCTAAGGTAGTTTAGAGGAGGG - Intergenic
1099282935 12:80675769-80675791 TGGGATGGGGATTTAGGGGTGGG + Intronic
1100586196 12:95982044-95982066 TGCTATAGGGATTCAGAGAATGG - Intronic
1101761950 12:107665853-107665875 TGCTATGGGGAATGAGTGGGTGG + Intergenic
1102419962 12:112795669-112795691 TGATATAGGGATTAAGAGGATGG + Intronic
1103174090 12:118846756-118846778 TGCTTAGGGAATTCAGAGGAGGG + Intergenic
1103361281 12:120355867-120355889 TACTCTGGGAATTCAGAGGAGGG - Intronic
1103869844 12:124083555-124083577 TGCTCTGGGGAATTAAGGGATGG - Intronic
1104339549 12:127935197-127935219 TGAGATGGGGAGTTAAAGGAGGG - Intergenic
1105971126 13:25429930-25429952 GGCTGTGGGGATTTTGAGGAGGG + Intronic
1106778611 13:33032924-33032946 TGCAATGGCGATTCAGAGGAAGG - Intronic
1108223889 13:48267517-48267539 TTCTATGGGGAGCTAAAGGAAGG - Exonic
1110172899 13:72523824-72523846 TGCTGAGGGTATTTACAGGATGG - Intergenic
1110942852 13:81372053-81372075 TACAGTGTGGATTTAGAGGATGG - Intergenic
1111677513 13:91405299-91405321 TGCTATTGGTATCTAGTGGATGG - Intronic
1112732749 13:102384591-102384613 TGCTATAGGGCTCAAGAGGAGGG - Intronic
1114820112 14:26008340-26008362 TGCTATGTGGATTTTCTGGAGGG - Intergenic
1115042236 14:28945552-28945574 TTCTTTAGGGGTTTAGAGGAGGG + Intergenic
1115367055 14:32570065-32570087 TGCTCTGGGCATTTAGAAGAGGG - Intronic
1117475864 14:56094517-56094539 TGCTATTGAAAATTAGAGGACGG + Intergenic
1117730602 14:58718395-58718417 GGCCATGGGGATTAAGAGGTGGG - Intergenic
1117826255 14:59706818-59706840 TGCTATTGGATTTCAGAGGAGGG - Intronic
1119376867 14:74201712-74201734 TGCTATAGGAATGTAGGGGAAGG - Intergenic
1119460183 14:74795601-74795623 TGATATGAGAATGTAGAGGAGGG - Intronic
1120178844 14:81323003-81323025 AGCTAAGGGGTTTTATAGGAGGG - Intronic
1121571286 14:94948476-94948498 TGAGATGGGAATTTAGTGGAAGG - Intergenic
1121812205 14:96901104-96901126 TGCTATGGGGATTTAGAGGAAGG - Intronic
1121986807 14:98514850-98514872 TGCTATTGGCATTTAGTGGGTGG - Intergenic
1125071707 15:35562502-35562524 AGCTATGGGCTTTTAGTGGAAGG + Intergenic
1125313085 15:38401940-38401962 TGTGATGGTGATTCAGAGGATGG + Intergenic
1125696276 15:41640024-41640046 TCCTTTGGTGGTTTAGAGGAAGG + Intronic
1125991922 15:44117922-44117944 TGCTTTGAGGAATTAGAGCAAGG + Intronic
1126834455 15:52645503-52645525 TGCTATGGGAATATTTAGGAGGG + Intronic
1128375549 15:67072559-67072581 TGAGATGGGGATTTGGGGGAGGG - Intronic
1129028810 15:72604296-72604318 TGCTGTTGGGATGGAGAGGAGGG + Intergenic
1130037737 15:80377017-80377039 TGCTATGGGCATCTTGAGGAAGG + Exonic
1131237555 15:90710253-90710275 TGCTATGTTTATTTAGAGAATGG - Intergenic
1131539338 15:93263092-93263114 TGCTGTTGGCATTTAGAGGGTGG - Intergenic
1132689576 16:1176558-1176580 TGCTGTGGGGATTCCGAGAATGG + Intronic
1133777166 16:8905912-8905934 TGCCAAGGGGATTTGGTGGAGGG - Intronic
1134307010 16:13042001-13042023 GGCAAAGGGGATTTTGAGGAGGG + Intronic
1134360311 16:13524902-13524924 TGCTATGGGCATTTAGTGATTGG - Intergenic
1137816022 16:51398075-51398097 AGCTATGAGGAATTACAGGAAGG + Intergenic
1139519270 16:67471028-67471050 TGCTCTGAGGCTCTAGAGGATGG - Intronic
1139970242 16:70769834-70769856 GGCTATGGGGATTGAGGGGGAGG - Intronic
1142933329 17:3307137-3307159 TGCTATGGGAAGACAGAGGAAGG + Intergenic
1143191786 17:5045241-5045263 TTCTATGGGAGTTCAGAGGAGGG - Intronic
1143690403 17:8558342-8558364 TGCTATGGGAACATAGAGAAAGG + Intronic
1146468816 17:33108354-33108376 TCCTCTGGGGATTGAGAGGTGGG + Intronic
1146508443 17:33425526-33425548 TGCCGTGGGGGTTCAGAGGATGG + Intronic
1146659784 17:34658070-34658092 TGCTATGGGAACTCAGGGGAAGG - Intergenic
1147648110 17:42046109-42046131 AGCTGTGGGGAACTAGAGGATGG - Intronic
1148177522 17:45580109-45580131 TGCAGTGGGCATTTAAAGGAGGG - Intergenic
1149064887 17:52467552-52467574 TGTAAAGGGGATTTTGAGGAAGG + Intergenic
1149259244 17:54860865-54860887 TGCACTGGGGATTCAGAGCAAGG - Intergenic
1149883721 17:60319072-60319094 TGTTATGAGGGTTTAGGGGAAGG + Intronic
1150384320 17:64746073-64746095 TCCCATGGGGAGTTAGAGGCAGG + Intergenic
1150771766 17:68048167-68048189 TCCCATGGGGAGTTAGAGGGAGG - Intergenic
1151811109 17:76442598-76442620 TGCCATGGGGCATGAGAGGAAGG + Intronic
1154031302 18:10756362-10756384 AGCTATGGGGATGTAGATAAAGG + Intronic
1154031374 18:10756732-10756754 AGCTATGGGGATGTGGATGAAGG + Intronic
1154031483 18:10757249-10757271 TGCTATGGGGATGAATATGAGGG + Intronic
1154031565 18:10757637-10757659 AGCTATGGGGATGCAGAGGAGGG + Intronic
1155304051 18:24462011-24462033 TGCTATGGTCACTTGGAGGAGGG + Intronic
1155334125 18:24747824-24747846 TTCTATGGGACTTGAGAGGAAGG - Intergenic
1156507883 18:37610020-37610042 TGCAATGGGTATTTTTAGGAAGG + Intergenic
1157573341 18:48728158-48728180 TATTATTGGGAATTAGAGGAAGG - Intronic
1157807220 18:50667105-50667127 TGCCATGGGAATTCAGAGAAAGG - Intronic
1157835352 18:50897054-50897076 TGCTATGGGGTTTCAGAGAAGGG - Intronic
1158120966 18:54047994-54048016 TGCCGTGGGCATCTAGAGGATGG + Intergenic
1158330348 18:56355703-56355725 TGCTATGATGAGTTATAGGAAGG - Intergenic
1160042611 18:75359567-75359589 TAGAATGGGGATTCAGAGGAAGG + Intergenic
1163226080 19:15962569-15962591 TGTTCTGGGAATTGAGAGGAGGG - Intergenic
1167761871 19:51454799-51454821 TGCTTTGGGGATTTATATCACGG + Intronic
925392172 2:3502893-3502915 TGTTGTGGGGATTGAGAGGATGG + Intronic
925406910 2:3611802-3611824 AGCTTTGGGGATTTTGTGGAGGG + Intronic
926036135 2:9637511-9637533 TGCTATGGGAGTTGAGAGAAGGG + Intergenic
926575640 2:14577405-14577427 TGCTTTGGTGATTTTGAGGATGG + Intergenic
926761524 2:16282690-16282712 AGCTGTGGGGATAGAGAGGATGG + Intergenic
926841533 2:17086353-17086375 TGCTATGGAAATTTCCAGGAAGG + Intergenic
927273985 2:21245959-21245981 GGCTATAGAGATTCAGAGGAAGG + Intergenic
927439613 2:23103873-23103895 TGCAATGGGGATGTGAAGGAGGG - Intergenic
929199739 2:39222209-39222231 TTCAATGGGGATTCAAAGGAAGG + Intronic
929845348 2:45520318-45520340 GGCCATGGGGCTTTGGAGGAGGG - Intronic
930376986 2:50580297-50580319 AGGTGTGGGGATTTATAGGAAGG - Intronic
931642908 2:64397041-64397063 TGCTATGGGAATTTGCATGAGGG - Intergenic
932315469 2:70779052-70779074 TACTTTGGGGATTTAGGGGCTGG - Intronic
932635008 2:73380440-73380462 TGCTATGGGGATTGATAGCCAGG + Intergenic
933394815 2:81717730-81717752 TATTATGGGGAGTTAGAGGGTGG + Intergenic
934587480 2:95515161-95515183 TGCTCTGGTGACTTAGAGCAGGG - Intergenic
934746462 2:96762722-96762744 GGCGATGGAGATTTAGAGTATGG + Intronic
938595810 2:132786044-132786066 TACTCTGGAGATTCAGAGGAGGG + Intronic
940189373 2:151023540-151023562 TGCTATGAGGATGCAGAGAAAGG + Intronic
941647296 2:168054872-168054894 AGCTATGGGTAGTTAGAGGAAGG - Intronic
942226403 2:173820456-173820478 TGCTATAGGGATTCAGAGAAAGG - Intergenic
942363617 2:175198422-175198444 TGCAATGGGTGTCTAGAGGATGG - Intergenic
942523481 2:176829159-176829181 TGATATGGGGGTTTTGAGAAGGG - Intergenic
943199593 2:184803376-184803398 TGCTATGTGAATATAAAGGAAGG - Intronic
943393646 2:187304355-187304377 TACTATAGGGATCTAGATGAAGG + Intergenic
944392955 2:199238272-199238294 TGTTATGGTGAATGAGAGGAGGG - Intergenic
944469357 2:200036357-200036379 AGCTATGGGGAATAATAGGAGGG - Intergenic
944911745 2:204317406-204317428 TGCTATGGGAACACAGAGGAGGG + Intergenic
946104671 2:217358716-217358738 TGCTTTGGGGATTCAGAGACGGG - Intronic
946221487 2:218231462-218231484 TACTATTGGTATTTCGAGGAAGG - Intronic
946355105 2:219179634-219179656 TGCTCTGGGGCTGCAGAGGAGGG + Intronic
946662635 2:222018034-222018056 TGCTATGGGGACCTAGGTGAAGG + Intergenic
946811904 2:223534652-223534674 TGCTGTGAGAGTTTAGAGGAGGG + Intergenic
947080342 2:226388926-226388948 TGCTTGGGGGTTTTAGAGGAAGG + Intergenic
949073761 2:242042017-242042039 TGATTTGGGGATTAAGAGAATGG + Intergenic
1168983185 20:2025139-2025161 TGCTGTGGGAGCTTAGAGGAAGG - Intergenic
1169700534 20:8441722-8441744 TCCTATGGGCAGATAGAGGAGGG + Intronic
1170569972 20:17627186-17627208 TCCTCCGGTGATTTAGAGGACGG - Intronic
1173050778 20:39559213-39559235 TACTATTGGGATATAGAGAAAGG - Intergenic
1173113167 20:40215267-40215289 TGCTGTGAGAATTTAGACGAGGG - Intergenic
1173464968 20:43273571-43273593 TGTTATGGGGATTGACAGCATGG - Intergenic
1173803276 20:45908273-45908295 TGCTTTGGGGATTCAGAGGAGGG - Intronic
1173916409 20:46711452-46711474 TGCTGTGGGGGTTAAGAGGATGG - Intronic
1173968764 20:47134097-47134119 TGCTATAAAGATTTAGAGGCTGG - Intronic
1174151829 20:48491222-48491244 TCACATGGGGATTTAGAGGGAGG + Intergenic
1174218989 20:48937234-48937256 TGCTGTGAGGATAAAGAGGAAGG - Intronic
1174255922 20:49254951-49254973 CTCTATGGAGAATTAGAGGAGGG - Intronic
1175300756 20:57941154-57941176 TGCTATATGGATCTAGGGGAGGG + Intergenic
1176669374 21:9718084-9718106 TGCCATGGGGTTTTACAGTAGGG + Intergenic
1177855347 21:26394520-26394542 TGGTGGTGGGATTTAGAGGATGG + Intergenic
1179590885 21:42407138-42407160 TGCTCTGGGGATGGAGAGGAGGG + Intronic
1179825396 21:43962591-43962613 TGCTAAAGGGATTTGGTGGAAGG - Intronic
1182821270 22:33218498-33218520 TGTTATGGGGATTTGGAAGAGGG - Intronic
1183095547 22:35549809-35549831 TGCTCTGGGGGTGCAGAGGAAGG + Intronic
1183310361 22:37106435-37106457 TGCGAGGGGCATTTAGAGGGAGG - Intronic
1183813043 22:40274232-40274254 ATCTATGGGGATTTACTGGAAGG - Intronic
1184252545 22:43268951-43268973 GGTTATGGGGATTGGGAGGAGGG + Intronic
1184565621 22:45289976-45289998 TGCTATGAGGATTTAGCAAAGGG - Intronic
1184580003 22:45410385-45410407 TGCTTTGTGGATATAGGGGAAGG - Intronic
949432161 3:3989413-3989435 TGCTATGGGAACATAGAAGAGGG + Intronic
949687899 3:6599086-6599108 TGCTAAGTGGAAGTAGAGGATGG + Intergenic
950503479 3:13378587-13378609 TGCTATGGACATTTAGAGGTTGG - Intronic
952604256 3:35125167-35125189 TTCCATGGGGATGGAGAGGAAGG - Intergenic
955851383 3:63223735-63223757 TGCTATGGGAATATAGAAGAGGG - Intergenic
956535618 3:70272745-70272767 AGCAAGGGGAATTTAGAGGAAGG - Intergenic
959079421 3:101784340-101784362 TGCTATGGGAACTCTGAGGATGG + Intronic
960332810 3:116383254-116383276 TGCTATAGAGATTTAGAAGAGGG - Intronic
960407035 3:117274421-117274443 TGCTATTGGCAATGAGAGGAAGG + Intergenic
961017708 3:123480473-123480495 GGCTTTGGGGATTTTGGGGAAGG + Intergenic
962153969 3:132924366-132924388 TGCAATGGGGTTTTAGAGTGAGG - Intergenic
963043491 3:141085869-141085891 TGCTTTGGGGCTTTGGGGGATGG - Intronic
963055647 3:141184445-141184467 TGCTATGTGATTTTAGAGGTTGG - Intergenic
963393214 3:144696481-144696503 TGCTACGGGGATTTGGTGTATGG + Intergenic
963430553 3:145196895-145196917 TGCTGTGGGGAGTTGGGGGATGG - Intergenic
963980929 3:151536101-151536123 TCCTAGGGGGATTAAGGGGATGG + Intergenic
964532230 3:157681236-157681258 TGCAATGGGGACTTGGAGGAAGG - Intergenic
965474026 3:169131844-169131866 TGCTTTGAGGATTCAGAGAAGGG - Intronic
966337254 3:178882272-178882294 GGCTATGGGAATTTAGAGCAAGG - Intergenic
966601341 3:181778278-181778300 TGCTATGGGAACATAGAGGAAGG - Intergenic
966744943 3:183266542-183266564 TGTTTTGGGGCTTCAGAGGATGG + Intronic
967170988 3:186823469-186823491 TACTTTGGAGATTTAGTGGAAGG - Intergenic
967297658 3:187980900-187980922 TGGCACTGGGATTTAGAGGAAGG - Intergenic
967355223 3:188561832-188561854 TGTAATGGGCATTTGGAGGAGGG + Intronic
967919309 3:194602633-194602655 TGCTCTGGGCACTCAGAGGAAGG + Intronic
969538928 4:7773819-7773841 TGCTTTTGGAGTTTAGAGGAGGG - Intronic
969606415 4:8204414-8204436 AGCAATGGGGATGCAGAGGAAGG - Intronic
970792341 4:19873377-19873399 TACTATAGGCATTTAGAGGGTGG + Intergenic
971443952 4:26721978-26722000 TACTATGGGAGTCTAGAGGAAGG - Intronic
972035491 4:34514483-34514505 TACCATGGGAACTTAGAGGAAGG - Intergenic
972272339 4:37523345-37523367 TGCTATGGGGAGTGAGAGAAGGG + Intronic
972706857 4:41553326-41553348 TGCTGTGGGAACATAGAGGAGGG + Intronic
973934399 4:55828409-55828431 TGCTATGGGAATCAAGAGGATGG - Intergenic
976000458 4:80368306-80368328 TTCTATGGTGATTTAGAGTAGGG + Intronic
976869536 4:89774359-89774381 TGCTATGGGAACCAAGAGGAAGG + Intronic
977681993 4:99807199-99807221 TGCCTTGGGGATTTTGAGGCTGG + Intergenic
980183154 4:129427054-129427076 TGCTACGGAAGTTTAGAGGAGGG + Intergenic
981011347 4:139928463-139928485 TGCTCTGGGAGTGTAGAGGAAGG + Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
983159929 4:164399871-164399893 TGCTATAGGAATCTAGAGGAGGG - Intergenic
984218091 4:176939715-176939737 TGCTACTGGGATTTAGAGTCTGG - Intergenic
985352775 4:189083913-189083935 TGCTGTGAGGTTTTATAGGATGG - Intergenic
985405398 4:189633384-189633406 TGCCATGGGGTTTTACAGTAGGG - Intergenic
987181332 5:15371740-15371762 TGCTATGGGAATTTAAAGGAGGG - Intergenic
987555240 5:19437854-19437876 TGCTCTGGGATTTCAGAGGAGGG - Intergenic
989220587 5:38957577-38957599 TGATTTGTGAATTTAGAGGATGG - Intronic
989635201 5:43524522-43524544 GGCTTTGGTGATTTAGGGGATGG - Intergenic
990949538 5:61284985-61285007 TGCTATGTGGATTGCCAGGATGG - Intergenic
994162233 5:96569555-96569577 TGTAATGGGGACTCAGAGGAGGG - Intronic
999311010 5:150552214-150552236 TGCTATGGGAATTCAGAACAAGG + Intronic
1000037906 5:157462741-157462763 TGCTCTGGGGTTTTCCAGGAGGG - Intronic
1001215829 5:169854898-169854920 TGCTCTGGGTACTTGGAGGATGG + Intronic
1001298436 5:170515800-170515822 CACTGTGGGGATTCAGAGGATGG + Intronic
1005273859 6:24195655-24195677 TGCTATGGGCATCTAGAAGGTGG - Intronic
1005743906 6:28818023-28818045 AGCTATGGGGATGGAGAGAAGGG + Intergenic
1007016105 6:38468529-38468551 TGCTCTAGGATTTTAGAGGAAGG - Intronic
1007131016 6:39473641-39473663 TGCTTTGGGGTTTTGGAGGCAGG + Intronic
1007463966 6:42038897-42038919 TGCTGTGGGAATCTGGAGGAAGG - Intronic
1007982431 6:46172412-46172434 TGGGATGGGGATTAAGAGGGAGG + Intergenic
1008494741 6:52121667-52121689 TAATATGGGGATAAAGAGGAGGG - Intergenic
1010786991 6:80015078-80015100 TGCTATGAGAATTCAGAAGAGGG + Intronic
1011534450 6:88360873-88360895 GGCTATGGAGATTCAAAGGAAGG - Intergenic
1012635222 6:101529768-101529790 TCCTATGGGAATTCAGAAGAAGG + Intronic
1014740964 6:125147305-125147327 TGGGATGGGAATTGAGAGGAAGG + Intronic
1015832940 6:137389219-137389241 TGCAATAGGGATTAGGAGGAAGG + Intergenic
1016957387 6:149639747-149639769 TGCAAGGGGACTTTAGAGGAGGG - Intronic
1017280676 6:152620979-152621001 AGCTAGAGGGGTTTAGAGGAAGG + Intronic
1022659744 7:32355619-32355641 TGCTAAGGGAACTTAGAGGAGGG - Intergenic
1022798764 7:33754899-33754921 TGCTATTTGTATTTAGATGATGG - Intergenic
1023420832 7:39977829-39977851 AGCTATGGGGATAAAGAGCATGG + Intronic
1023728497 7:43168022-43168044 GGCTATGGGGATTTAGAGATGGG - Intronic
1024000636 7:45187200-45187222 TCCTCCGGGGATTTTGAGGAAGG + Intergenic
1028464406 7:91134194-91134216 TGCTTTGTGGGTTGAGAGGATGG + Intronic
1029536279 7:101159675-101159697 GGCTATGGGGATTTGGGGGCTGG + Intronic
1029542484 7:101192357-101192379 AGCTATGGGGATGGCGAGGAGGG + Intergenic
1029625623 7:101718650-101718672 TGGTATGGGGATTCATAGGAGGG + Intergenic
1030294177 7:107903891-107903913 TACTATGGGGAGATAGAGGAAGG + Intronic
1030392966 7:108950113-108950135 TGTTATAGGGATTTAAAAGAAGG - Intergenic
1032418849 7:131761684-131761706 TGCTACGGGAAGTGAGAGGAGGG + Intergenic
1032733864 7:134672011-134672033 TGCTATGGTGACTTAGGGGAGGG + Intronic
1032899186 7:136287700-136287722 TGTTATGGTGACATAGAGGAAGG + Intergenic
1033943451 7:146683922-146683944 TGCTATGACTATTTACAGGATGG - Intronic
1033951111 7:146786361-146786383 TGCTAAGGGTATTAAGAGAAGGG - Intronic
1034461626 7:151200767-151200789 TGCTCTGGGGATTCTGAGGAGGG - Intronic
1034676860 7:152898264-152898286 TGCTCTTGGGATTTGCAGGAAGG - Intergenic
1037492363 8:19408403-19408425 TGCTTTGGGAGGTTAGAGGAGGG - Intronic
1037847599 8:22297625-22297647 TGCAGTGGGGATTTACAGTATGG + Intronic
1038048418 8:23786848-23786870 TGCTCTGGGGATCTAGGAGAAGG + Intergenic
1038248398 8:25880856-25880878 TGCTAAGGGAGTTCAGAGGAAGG - Intronic
1038528046 8:28294085-28294107 TGCAAGGGGGTTTTATAGGATGG - Intergenic
1039759295 8:40557613-40557635 TGCTATGGGAATATAAAAGAGGG - Intronic
1040405183 8:47094702-47094724 TGCTATGGGTATGTAAAGGTAGG + Intergenic
1041198149 8:55422377-55422399 AGCACTGGGGATTTAAAGGAAGG + Intronic
1041865148 8:62564240-62564262 GGCCAAAGGGATTTAGAGGAGGG - Intronic
1041873391 8:62660790-62660812 AGGTATGTGGACTTAGAGGATGG - Intronic
1042331753 8:67587788-67587810 GGCTATGGTGAATTCGAGGATGG + Intronic
1042398966 8:68323702-68323724 TGCTATGGGGTTTTGCAGTAAGG - Intronic
1042769691 8:72366202-72366224 TGCTATGTGGGTTTATAGGTGGG - Intergenic
1042867343 8:73367426-73367448 TCCTTTGGGACTTTAGAGGAGGG + Intergenic
1043477440 8:80619147-80619169 TGCTGTGGGGATTTAGGGAGAGG - Intergenic
1045989922 8:108295113-108295135 TGCTTTGAAGATTTATAGGAAGG + Intronic
1046316277 8:112506752-112506774 TGCTATGCGGATATGGATGAGGG + Exonic
1046373969 8:113351027-113351049 TGCTATGGTAATTTAAAGGCAGG - Intronic
1046514230 8:115237949-115237971 TGTTATGGGTATTCACAGGATGG - Intergenic
1047230236 8:122991912-122991934 CGCTAAGGGGAATGAGAGGAAGG - Intergenic
1050713101 9:8488109-8488131 TACCATGGGGATATAGATGAAGG + Intronic
1053112398 9:35473099-35473121 TCATATGGTGATTTAAAGGAGGG - Intergenic
1053378656 9:37630116-37630138 TGTGATGGGGATTTAGAAGGTGG - Intronic
1054825172 9:69566175-69566197 TGCTATGGGGATATGCAGCACGG - Intronic
1056867806 9:90245248-90245270 TGAGATGGGTATTTACAGGATGG - Intergenic
1057830062 9:98399434-98399456 AGCTGTGGGCATTCAGAGGAGGG - Intronic
1058961421 9:109995890-109995912 TGCCATGAGGATGGAGAGGAAGG + Intronic
1059627506 9:116083103-116083125 TACCATGGGGACATAGAGGAAGG - Intergenic
1060034527 9:120243600-120243622 TGCTTTGGGGGCATAGAGGAAGG + Intergenic
1061872500 9:133528320-133528342 TGCCATGGGGATTCTGAGCAGGG - Intronic
1203656493 Un_KI270753v1:2852-2874 TGCCATGGGGTTTTACAGTAGGG - Intergenic
1185665153 X:1759785-1759807 TGCTCTGGAGATCAAGAGGAAGG + Intergenic
1185694317 X:2183880-2183902 TGCTATGGGCATCTAGTGGGTGG + Intergenic
1186772453 X:12831157-12831179 TGCTATCGGCATTTAGTGGGTGG - Intergenic
1186909554 X:14147633-14147655 TGTTATGAGAATATAGAGGATGG - Intergenic
1187107630 X:16260616-16260638 TGCTATGGGAATGTGGAGAAGGG + Intergenic
1188432945 X:30127220-30127242 TGCTATAGGGAATAAGAGCAAGG + Intergenic
1190177839 X:48166294-48166316 TGATATGGGGAATCAGAGGAGGG - Intergenic
1190193339 X:48295484-48295506 TGATACGGGGAATCAGAGGAGGG + Intergenic
1190659843 X:52644095-52644117 TGATACGGGGAATCAGAGGAGGG + Exonic
1190676886 X:52790249-52790271 TGATACGGGGAATCAGAGGAGGG - Intronic
1190868197 X:54402369-54402391 TGGTTTGGTGATTTGGAGGAGGG + Intergenic
1191701823 X:64050238-64050260 TGCTAGGGGGATTGGGTGGAGGG + Intergenic
1192070868 X:67940131-67940153 GGCTATAGAGACTTAGAGGAGGG - Intergenic
1192590561 X:72356262-72356284 TGCAAAGGGGGTATAGAGGATGG + Intronic
1192591057 X:72359731-72359753 TGCTGTGGGGATGGAGTGGATGG + Intronic
1192901285 X:75500104-75500126 GACTTTGGGGATTTAGGGGAAGG + Intronic
1193585016 X:83310954-83310976 TGCTGTCTGGAGTTAGAGGAGGG - Intergenic
1194295648 X:92123235-92123257 TGCTGTGGTGAGTTAGAGAAGGG - Intronic
1194570767 X:95551894-95551916 TGGAATGGGGATATATAGGATGG - Intergenic
1194600553 X:95915625-95915647 TGCTATGTGAATTTGGGGGAAGG - Intergenic
1194646311 X:96462938-96462960 TGCTTTGGGGATTTATGTGAGGG + Intergenic
1194979855 X:100429127-100429149 TGCTATGGGGACTAAGTGGCAGG - Intergenic
1195624916 X:106997906-106997928 TGCTGTGGGAGTTCAGAGGAAGG - Intronic
1197528437 X:127592148-127592170 TTTTATGGGAATTCAGAGGAGGG - Intergenic
1197703742 X:129618907-129618929 GGCTATGGAAAGTTAGAGGAGGG - Intergenic
1197950453 X:131890335-131890357 TGCTGTTGGGAATTAGAGGAGGG - Intergenic
1198117656 X:133559551-133559573 TGCCATGGGGATTCTGAGCAGGG + Intronic
1199084504 X:143613142-143613164 TACTATGGGGATATATAGGTGGG + Intergenic
1199234736 X:145478042-145478064 GGCTGTGGGGATGAAGAGGAAGG + Intergenic
1199770532 X:150972565-150972587 TGCTCTGGGGACATAGAGGTGGG - Intergenic
1199804810 X:151287980-151288002 TGCCATGGGCATTCTGAGGAGGG - Intergenic
1200322957 X:155208955-155208977 TGCTCTGGGGATGGAGTGGAAGG - Intronic
1202575661 Y:26321972-26321994 TGCTATGAGAGTGTAGAGGAGGG - Intergenic