ID: 1121812530

View in Genome Browser
Species Human (GRCh38)
Location 14:96903963-96903985
Sequence GTGATGCCCTGTGTGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 211}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121812525_1121812530 5 Left 1121812525 14:96903935-96903957 CCCAGCTTGGAAATGCCAGTCTT 0: 1
1: 0
2: 2
3: 20
4: 211
Right 1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 211
1121812522_1121812530 20 Left 1121812522 14:96903920-96903942 CCTCAATCTGCAGTCCCCAGCTT 0: 1
1: 0
2: 1
3: 19
4: 212
Right 1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 211
1121812527_1121812530 -10 Left 1121812527 14:96903950-96903972 CCAGTCTTTCTCTGTGATGCCCT 0: 1
1: 0
2: 0
3: 44
4: 318
Right 1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 211
1121812524_1121812530 6 Left 1121812524 14:96903934-96903956 CCCCAGCTTGGAAATGCCAGTCT 0: 1
1: 0
2: 2
3: 20
4: 252
Right 1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 211
1121812526_1121812530 4 Left 1121812526 14:96903936-96903958 CCAGCTTGGAAATGCCAGTCTTT 0: 1
1: 0
2: 0
3: 15
4: 196
Right 1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121812530 Original CRISPR GTGATGCCCTGTGTGGTTCT GGG Intronic
900119834 1:1043832-1043854 GAGATGCCGTGTGTGCTTTTGGG + Exonic
900787702 1:4659011-4659033 GTGGGGCCCTGTGTGCTCCTGGG + Intronic
903282735 1:22259219-22259241 CAGAGGCTCTGTGTGGTTCTTGG + Intergenic
904055396 1:27666749-27666771 GTGGAGCCCTGTGTGGGTGTGGG + Intronic
905905752 1:41617397-41617419 GAGATGTTCTGTGTGGTCCTCGG - Intronic
907808932 1:57849278-57849300 GTGCTGCCCTGTCTGCTCCTTGG + Intronic
908475366 1:64482533-64482555 TTGCTGCCCTGAGTGGTTTTGGG + Intronic
913167652 1:116203396-116203418 GTGCTGGCCTGTCTGGTTCTTGG - Intergenic
917589653 1:176463157-176463179 GTCATGCCCAGTGGGGTTCAGGG - Exonic
917925488 1:179786210-179786232 GTTAGGGCCTGTGTGGCTCTGGG - Intronic
920080205 1:203367533-203367555 CTGTTGCCCTGGGTGGTCCTGGG - Intergenic
920855862 1:209661036-209661058 GAGATGGCATGTGTGCTTCTTGG + Intergenic
921701624 1:218274949-218274971 GGGATGCCCTGTGTTGCTTTGGG + Intergenic
922860284 1:228810570-228810592 GGGAGGCCCAGTGAGGTTCTGGG + Intergenic
924198551 1:241637035-241637057 GTGATGCCCTGTGTGGCCAGAGG + Intronic
924932644 1:248744369-248744391 GTGATGCCCTGGGTGGGTGCTGG - Intronic
924932958 1:248746846-248746868 GTGATGCCCTGGGTGGGTGCTGG - Intronic
1063075721 10:2714198-2714220 GTGATGCCCTCTGTGTTAGTGGG - Intergenic
1065084694 10:22163102-22163124 GTTATGTGCAGTGTGGTTCTTGG - Intergenic
1067568576 10:47355310-47355332 GTGAGGCCCTGTGTGCCCCTCGG - Intronic
1068436283 10:56995156-56995178 GTGATGCCCTGTGCTGCTTTAGG + Intergenic
1069571086 10:69494865-69494887 GTGGGGCCCTTTGTGCTTCTGGG + Intronic
1070977357 10:80615595-80615617 GGGATGCCCTGTTTGGTCTTTGG + Intronic
1071672604 10:87622980-87623002 TTGATGCCCAGCGTGGTTCAAGG - Intergenic
1072192871 10:93090410-93090432 GTGCTGGCCAGTGTGGTTCCTGG + Intergenic
1072617008 10:97056707-97056729 GAGATGCCCTGTGGGATTCCGGG + Intronic
1073049652 10:100659381-100659403 GTGAGGCACTGCGTGGGTCTGGG - Intergenic
1074129845 10:110564320-110564342 GTGATGCCATGTGTTGTTAATGG + Intergenic
1075745707 10:124725903-124725925 GGGTTGGCCTGTGTGGGTCTTGG - Intronic
1075845305 10:125540474-125540496 GTCATGCTGTGTGTGGCTCTGGG + Intergenic
1076911364 10:133391821-133391843 GTGGGGCCATGTGTGGTTGTGGG - Intronic
1077488968 11:2851752-2851774 GTGATGCCCTGCTTGGGTCCTGG - Intergenic
1077510122 11:2955163-2955185 GTGGTGCACTGTGTAGTTCCAGG - Intronic
1077515845 11:3001680-3001702 GTGAGGGCCTGGGTGGATCTTGG + Intronic
1077842439 11:5990393-5990415 GTGATGCTCTGGGTGCTTCATGG + Intergenic
1077849461 11:6061553-6061575 GTGATGCTCTGGGTGCTTCATGG + Intergenic
1077905157 11:6526976-6526998 GTGATGCCATGTGTGTTTTGAGG + Intronic
1078060546 11:8040062-8040084 ATGATTCCCTCTGTGGTCCTAGG - Intronic
1082096680 11:48136366-48136388 ATGATGGCCAGTGTGCTTCTGGG + Intronic
1083615342 11:64023447-64023469 GTGAAGCCCTGTGAGGCTGTAGG - Intronic
1084062606 11:66685995-66686017 GTCATGCCCCGGGTGGTGCTGGG + Exonic
1084264438 11:67997622-67997644 GTGAAGCAGAGTGTGGTTCTGGG - Intronic
1084430762 11:69109725-69109747 GTGCTGCCCTGTCTTGATCTTGG - Intergenic
1084514375 11:69628301-69628323 GTGATGACATGTGCGGCTCTGGG - Intergenic
1089035562 11:115386546-115386568 GTGATGCCCTGAGCCGTCCTGGG - Intronic
1090860691 11:130649952-130649974 GTAAGGCTCTGAGTGGTTCTTGG - Intergenic
1093132184 12:15404911-15404933 GTGCTGGCCAGTTTGGTTCTTGG + Intronic
1093163794 12:15781817-15781839 GTGATGCTCTCTGTTGTCCTGGG - Intronic
1100692544 12:97053859-97053881 GTGATCCCCTCTTTGATTCTGGG - Intergenic
1102034029 12:109760813-109760835 GGGACGCCATGTGTGGTTCCAGG + Intronic
1102959793 12:117085107-117085129 GTGATGCCCAATGGGGTTCTGGG + Intronic
1103987408 12:124777267-124777289 GACATGCCCCGTGTTGTTCTAGG - Intronic
1104552034 12:129766036-129766058 GAAGTGCCCTGTGTGATTCTGGG + Intronic
1104836470 12:131795357-131795379 GGGCTCCCTTGTGTGGTTCTGGG - Intronic
1104916492 12:132267475-132267497 GTGAAGCCCTCTGGGGTGCTGGG - Intronic
1107376776 13:39812071-39812093 GTTAACCCCTGTGTGGTTGTAGG - Intergenic
1107782152 13:43915302-43915324 GTGATGCTCTGTGAGGTGTTAGG - Intergenic
1108355053 13:49622481-49622503 GTGATGTCCAGTATGGGTCTGGG + Intergenic
1110371958 13:74750453-74750475 GTGATGTCATGTGTGGTACAGGG - Intergenic
1110992977 13:82067911-82067933 TTGATGCTCTCTGTGGTTTTAGG - Intergenic
1113877069 13:113601291-113601313 GTGGTGCCCTGAGTTGGTCTGGG + Intronic
1113890065 13:113731048-113731070 GGGCTGCCCTGTGTGTTACTGGG - Intronic
1118762925 14:68891722-68891744 ATTATGCCCTGTTTGGTTCAGGG + Intronic
1119148816 14:72339864-72339886 GGGACCCCCTGTGAGGTTCTAGG + Intronic
1121399194 14:93657278-93657300 GTGAAGCCCTGATTGGTTCTCGG - Intronic
1121692513 14:95888111-95888133 CTAATTCCCTGTGTGATTCTTGG + Intergenic
1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG + Intronic
1121951457 14:98174333-98174355 GTGAAACTGTGTGTGGTTCTTGG + Intergenic
1129771278 15:78204906-78204928 GTGAAGCCCTTTGTGGGTCAAGG - Intronic
1132104123 15:99050597-99050619 CCCATGCCCTGTGTGGCTCTGGG + Intergenic
1132743179 16:1426106-1426128 GTGATTCCAGGTGGGGTTCTGGG - Intergenic
1135843897 16:25901044-25901066 GTAATGACCTGTGTGGTATTAGG + Intronic
1137342075 16:47617965-47617987 GTGATTCCCTGTGTGGTACATGG + Intronic
1139463550 16:67141795-67141817 TTGGGGCTCTGTGTGGTTCTTGG - Intronic
1144711639 17:17405180-17405202 GTGATGCCCTGTGTAGCCTTGGG + Intergenic
1145905182 17:28512393-28512415 GTCAAGCCCTGAGTGGTTCTAGG + Intronic
1146562968 17:33887602-33887624 GTGAGACCTTTTGTGGTTCTGGG + Intronic
1146956972 17:36941541-36941563 CTGATGCCCTGCGTGGCTGTGGG + Intronic
1147654704 17:42082240-42082262 GTCATACCCTGTGAGGTGCTGGG - Intergenic
1148086888 17:44998927-44998949 GTTATGCCCTGTGTGTCTCAAGG - Intergenic
1148676841 17:49450751-49450773 GTGATGCTGTGTGTGCTCCTGGG - Intronic
1149073210 17:52568466-52568488 GTTTTGCCTGGTGTGGTTCTAGG + Intergenic
1149918582 17:60634980-60635002 GTGTTGCCCGGGGTGGTCCTGGG + Intronic
1150866930 17:68861187-68861209 ACCATGCTCTGTGTGGTTCTAGG + Intergenic
1151803590 17:76391812-76391834 ATGGTGCCCTGTGTGTTTCAGGG - Exonic
1154391332 18:13938923-13938945 CTGCTGCCCAGTGTGGCTCTGGG - Intergenic
1155773364 18:29727354-29727376 GTGGTGAACTGTGTGGATCTGGG + Intergenic
1156465020 18:37343273-37343295 GTGAGGCCCTGTGTGCATTTGGG + Intronic
1160764655 19:802093-802115 GTGACGCCCTGAGTGCTTGTGGG + Intronic
1161018765 19:1997687-1997709 GTGAGGCCCTGTGTGGCCCAGGG - Intronic
1161041174 19:2111484-2111506 GTGGTGGGCTGTGTGGTCCTGGG - Intronic
1161283305 19:3456986-3457008 GTGATGCACTGTGTGACCCTGGG - Intronic
1165332994 19:35151680-35151702 GTGAGAAACTGTGTGGTTCTGGG + Intronic
1167997139 19:53414773-53414795 GTGGTGACCTGTGTGGTCCTTGG - Intronic
1168006904 19:53497428-53497450 GCGGTGACCTGTGTGGTCCTTGG - Intergenic
925254821 2:2474453-2474475 GTGCTGGCCTCTGTGGTTCTGGG + Intergenic
925407242 2:3613574-3613596 GTGCTGACCTGTGGGGCTCTAGG + Intronic
925749602 2:7075769-7075791 GTGATGCCATGTGTCTTTCAAGG - Intergenic
928252560 2:29694809-29694831 GTGATGTCCTGGGTGGGTCAGGG - Intronic
928704502 2:33933407-33933429 AGGATGCCCTATGTGGATCTGGG + Intergenic
929094594 2:38251433-38251455 GTGATCCACTGGGTGGCTCTTGG + Intergenic
929591382 2:43149333-43149355 GTGATGCTCTCTGTGGTCTTAGG + Intergenic
931354339 2:61521666-61521688 GTTTTGCCTTTTGTGGTTCTGGG - Intronic
931901586 2:66795255-66795277 ATGATGTCCAGTGTGTTTCTGGG + Intergenic
935259364 2:101341833-101341855 GTTATTACCTGTGTGATTCTGGG + Intergenic
936019540 2:108984334-108984356 CTCACGCCCTGTGTTGTTCTGGG - Intronic
938245361 2:129772611-129772633 GTTGTTCCCTGTGTGGTCCTGGG - Intergenic
938694471 2:133822981-133823003 GAGCTGCCTTGTGTGTTTCTTGG - Intergenic
939902418 2:147866429-147866451 GTGATGCCATGCTTGGTTCAGGG + Intronic
942718651 2:178923701-178923723 GTGAGGCCCTGTGTGTTTCCAGG + Intronic
943795651 2:191989748-191989770 GTGCTGCCCTTGTTGGTTCTTGG + Intronic
944787292 2:203086317-203086339 GGCATTCCCTGTTTGGTTCTAGG + Intronic
948530528 2:238600739-238600761 CTGGTCCCCTGTGTGGTTCCTGG + Intergenic
949077249 2:242068803-242068825 GCGTAGCCCTGTGTGGTTCCTGG + Intergenic
1169356365 20:4909979-4910001 GTGCTGCCCTGTGTGCCACTGGG - Intronic
1169806512 20:9565953-9565975 TTGTTTCCCTGTGTGTTTCTCGG + Exonic
1170136830 20:13083834-13083856 GTGTTGACCAGTGTGGTTGTGGG - Intronic
1172564341 20:35917166-35917188 ATGGTGGCCTGTGTGGTTCATGG + Intronic
1173586312 20:44186191-44186213 GTGATTTGCTGTGTGGTTTTGGG - Intronic
1175381931 20:58569478-58569500 GTGCTGGCCTATGTGGGTCTGGG - Intergenic
1175419021 20:58819848-58819870 GTGGTCACCTGTGTGGGTCTGGG - Intergenic
1175575158 20:60055552-60055574 TTGCTGCCCTCTGTGGTTCCAGG - Intergenic
1177462286 21:21428563-21428585 GTGATGCCATTAGTGGCTCTTGG - Intronic
1177551392 21:22627027-22627049 GTGATGCCCTGTGCTGTCTTGGG - Intergenic
1178327924 21:31660138-31660160 GTGCTGCCCTCTGTGGTCCTTGG + Intronic
1179883059 21:44301388-44301410 GTCCTGTCCTGTGTGGCTCTGGG + Intronic
1179883397 21:44302816-44302838 GTCCTGTCCTGTGTGGCTCTGGG + Intronic
1182555882 22:31128077-31128099 GACATGCTCTGTGTGCTTCTGGG - Intronic
1182828534 22:33285810-33285832 CTGATGTCCTGTGTCCTTCTGGG - Intronic
1183241770 22:36662957-36662979 TTGATTCCCTGTGTGGTGCAGGG - Intronic
1184200506 22:42965561-42965583 CTGAGGCACTTTGTGGTTCTTGG - Intronic
950902705 3:16512502-16512524 CAGCTGCCCTGTGTGGTTATGGG - Intronic
952855651 3:37768804-37768826 GTCATCCCCAGTGTGGTTTTTGG - Intronic
953397804 3:42586962-42586984 GGGATGCCTTCTGGGGTTCTGGG - Intronic
954287805 3:49631172-49631194 GTGTTTGCTTGTGTGGTTCTTGG - Intronic
954682056 3:52351194-52351216 CTGGTGCCCTTTGGGGTTCTTGG + Intronic
954705602 3:52479011-52479033 GTGATGCTCTGATTGGTCCTTGG + Intronic
959385929 3:105706475-105706497 GTGAGGCCCTGTGACTTTCTGGG - Intronic
963886636 3:150590021-150590043 GTAATGCTCTGTTTTGTTCTTGG + Intronic
964422917 3:156523256-156523278 GTTATGCCATGTCTGCTTCTAGG + Intronic
966493293 3:180552306-180552328 GTGATGCCATGTGTGGTAGTGGG - Intergenic
967327568 3:188257299-188257321 TTGATGAGCTGTGTGGTCCTGGG + Intronic
968077451 3:195824363-195824385 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077459 3:195824399-195824421 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077467 3:195824435-195824457 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077475 3:195824471-195824493 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077483 3:195824507-195824529 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077491 3:195824543-195824565 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077499 3:195824579-195824601 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077507 3:195824615-195824637 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077515 3:195824651-195824673 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077523 3:195824687-195824709 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077531 3:195824723-195824745 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077539 3:195824759-195824781 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077547 3:195824795-195824817 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077562 3:195824867-195824889 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968077570 3:195824903-195824925 CAGGTGCCCTGTGTGGTTTTGGG + Intergenic
968875862 4:3267662-3267684 GTGAGGCCCTGCCTGGCTCTCGG - Intronic
969874821 4:10128397-10128419 TTTATGCCCTGTGTGCATCTGGG - Intergenic
975322693 4:73026175-73026197 GTGATGCCCTGTGATGATCAGGG + Intergenic
976139341 4:81974354-81974376 GTGATACCCTGGGTGGTTTGGGG - Intronic
981719275 4:147782565-147782587 GTAAAGCCCTGTGTGGTAATCGG + Intronic
984289123 4:177770696-177770718 GTGATGCCCTGTCTGGTAGGTGG - Intronic
986140492 5:5025618-5025640 TCCATGCCCTGTGTGGCTCTCGG - Intergenic
987091007 5:14507662-14507684 GAGCTGCCCTGTGTGGATCTGGG + Intronic
989146082 5:38251511-38251533 GTTGTGTCCTGTGTGGTTCATGG + Intergenic
990457869 5:56005431-56005453 GTTGTGTCCTTTGTGGTTCTTGG + Intergenic
991029328 5:62066387-62066409 TTGTTGCCCTCTGTGGCTCTTGG - Intergenic
993300568 5:86204429-86204451 GGAATGCCCTGAGTAGTTCTGGG - Intergenic
998543990 5:143010415-143010437 ATGTTGCCATGTGTGGTGCTTGG + Intronic
1000130039 5:158288326-158288348 ATGAGGCTCTGTGTGTTTCTTGG + Intergenic
1001400179 5:171441783-171441805 GTGATGCCCTGTGTGTGTCAGGG + Intronic
1001420169 5:171580074-171580096 GAGATGCCATGGGAGGTTCTTGG + Intergenic
1003527201 6:6908364-6908386 GTGATGAGCTGTCCGGTTCTGGG + Intergenic
1004252326 6:14032779-14032801 GTGATGCCCTGCATGGTTCATGG + Intergenic
1004252351 6:14032894-14032916 GTGATGCCCTGCATGGTTCATGG + Intergenic
1005271964 6:24175531-24175553 GTCATGGCCTGTGTGGTTTGGGG - Intronic
1005749532 6:28870108-28870130 GTGATGCCATGTGTGCTAGTGGG + Intergenic
1007096220 6:39214822-39214844 GTGAGGGCCTGTGTGCTTCAAGG - Intronic
1007186205 6:39974579-39974601 CTGATGCCCTTTGTGGTCGTGGG + Intergenic
1009742841 6:67769716-67769738 ATGATGCCCTCTGTTGTTCAGGG - Intergenic
1012685018 6:102235708-102235730 TTCGTTCCCTGTGTGGTTCTAGG - Intergenic
1016808015 6:148232733-148232755 GTGATGCACAGTGGGGTTGTAGG - Intergenic
1016873636 6:148842888-148842910 GACATACTCTGTGTGGTTCTGGG + Intronic
1017105635 6:150885034-150885056 GTGAAGCCCTGTATGGCTTTAGG + Intronic
1017251073 6:152280102-152280124 GTGATGTCCTTTGTGGGTCTGGG - Intronic
1018715632 6:166530472-166530494 GTGACGCCCTGTGTGGCACGGGG + Intronic
1019390477 7:783921-783943 GAGATGCCCTGTGCAGTCCTGGG - Intronic
1021183349 7:17533991-17534013 GCGATGCCCTGTGTGGCCTTGGG - Intergenic
1022644548 7:32218182-32218204 GTGATGCCTTTTATGGCTCTGGG - Intronic
1022845833 7:34209049-34209071 GTGATTCCCTGTGTGTTTGGTGG + Intergenic
1023830405 7:44035979-44036001 ATTATGCTCTGTGTGGCTCTGGG - Intergenic
1027454538 7:78373088-78373110 GTGATGCGCACTGTGGTTCCAGG - Intronic
1027883474 7:83873003-83873025 CTGGTGCCATGTGTGGCTCTAGG + Intergenic
1031749045 7:125547151-125547173 GTGCTGGCCAGTGTGGTTCCTGG - Intergenic
1035090441 7:156305782-156305804 GAGATGCGCTCTGTGGCTCTGGG - Intergenic
1035263376 7:157675387-157675409 GTGAGCCCCTGTGTGGTCCGGGG - Intronic
1035324645 7:158057048-158057070 GTCACGCCCTCTGTGGTTATTGG + Intronic
1035565853 8:640625-640647 GTGTTGCCCTGCGAGGATCTGGG + Intronic
1035578132 8:721599-721621 CTGATGCCCTTGCTGGTTCTTGG + Intronic
1035737614 8:1899982-1900004 GTGAGTCCCTGGGTCGTTCTTGG + Intronic
1037037038 8:14180666-14180688 GTGATGCCATGTGTGGTAGTAGG - Intronic
1037885280 8:22592783-22592805 GTGATTCTCAGTGTGGTCCTGGG - Intronic
1039197060 8:35044321-35044343 GTGATGCCCTGTGCCACTCTGGG - Intergenic
1039398552 8:37247902-37247924 GAGATGCCGTGTGTGTTTTTGGG + Intergenic
1039829603 8:41202356-41202378 GTGATGCCCTGGGAGGGGCTTGG - Intergenic
1040330017 8:46381130-46381152 GTGAAGCCCTGGGGGCTTCTGGG - Intergenic
1040933981 8:52764451-52764473 ATGATGCCATGTGTGGTAGTGGG - Intergenic
1042721411 8:71830616-71830638 GTTATTCCCTGTGTGGCCCTTGG + Intronic
1047642005 8:126830711-126830733 CTTGTGCTCTGTGTGGTTCTAGG + Intergenic
1048600442 8:135913958-135913980 GTGGTGCCCTAAGTGGTTCTGGG + Intergenic
1049378749 8:142301619-142301641 GTGAGTGCCTGTGTGGTTGTGGG + Intronic
1050470389 9:5982567-5982589 GTGATGCCCTGTGCAGTTTCGGG + Intronic
1053016318 9:34664366-34664388 GTGGTGCCCTTTCTGGTGCTGGG + Exonic
1059577847 9:115510103-115510125 GTTAAACCCTGTCTGGTTCTTGG - Intergenic
1059632186 9:116136500-116136522 TTGATGCCCTCTGTGATTGTAGG + Intergenic
1059939981 9:119349255-119349277 GTGTTCCCCTGTGTGTATCTAGG - Intronic
1061538925 9:131266872-131266894 GAGATGCCCTGTGGGCTTCGAGG - Intronic
1062076773 9:134594022-134594044 GTGATGTCTTGTGGGGTGCTGGG + Intergenic
1062450024 9:136611273-136611295 GGGCTGCCCTGTGTGTGTCTGGG + Intergenic
1062536651 9:137024002-137024024 CTGCTCCCCTGTGTGGTCCTGGG - Intronic
1187212341 X:17243866-17243888 GAGTTGCCCTCTGTGGATCTTGG - Intergenic
1187242812 X:17528945-17528967 GTGTTGCCCTGTGTATATCTGGG + Intronic
1192307851 X:69982338-69982360 GTAAAGCCCTTTGTGTTTCTTGG - Intronic
1195724269 X:107898036-107898058 GTGATCACCTGAGTGGTCCTGGG + Intronic
1196710659 X:118758693-118758715 GTGATGCCCTGTGCTGTCTTGGG - Intronic
1197390956 X:125863575-125863597 GTGATCCTCTGTATGATTCTGGG - Intergenic
1197706457 X:129637958-129637980 CTGATTCCCTCTGTGGCTCTAGG - Intergenic
1200118602 X:153780180-153780202 GTGCTGCCCTGGATGCTTCTGGG + Intronic