ID: 1121820523

View in Genome Browser
Species Human (GRCh38)
Location 14:96962181-96962203
Sequence CCCAGCCCTGGGAGGGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121820523_1121820531 -8 Left 1121820523 14:96962181-96962203 CCTAACACCCTCCCAGGGCTGGG No data
Right 1121820531 14:96962196-96962218 GGGCTGGGGACAAAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121820523 Original CRISPR CCCAGCCCTGGGAGGGTGTT AGG (reversed) Intergenic
No off target data available for this crispr