ID: 1121820769

View in Genome Browser
Species Human (GRCh38)
Location 14:96964312-96964334
Sequence CTCCCAGCACACAGCCGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121820769_1121820781 13 Left 1121820769 14:96964312-96964334 CCCCCTCGGCTGTGTGCTGGGAG No data
Right 1121820781 14:96964348-96964370 ATGGCCCCTTTGCAAGCTTCTGG No data
1121820769_1121820779 -6 Left 1121820769 14:96964312-96964334 CCCCCTCGGCTGTGTGCTGGGAG No data
Right 1121820779 14:96964329-96964351 TGGGAGGACCTGGTGGGGGATGG No data
1121820769_1121820778 -10 Left 1121820769 14:96964312-96964334 CCCCCTCGGCTGTGTGCTGGGAG No data
Right 1121820778 14:96964325-96964347 GTGCTGGGAGGACCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121820769 Original CRISPR CTCCCAGCACACAGCCGAGG GGG (reversed) Intergenic
No off target data available for this crispr