ID: 1121825769

View in Genome Browser
Species Human (GRCh38)
Location 14:97008400-97008422
Sequence GGGTGGGTGAATCCACTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121825769_1121825782 5 Left 1121825769 14:97008400-97008422 CCCCAAAGTGGATTCACCCACCC No data
Right 1121825782 14:97008428-97008450 AGGAACCTGGAAGTTGTTTGGGG No data
1121825769_1121825780 3 Left 1121825769 14:97008400-97008422 CCCCAAAGTGGATTCACCCACCC No data
Right 1121825780 14:97008426-97008448 GCAGGAACCTGGAAGTTGTTTGG No data
1121825769_1121825774 -8 Left 1121825769 14:97008400-97008422 CCCCAAAGTGGATTCACCCACCC No data
Right 1121825774 14:97008415-97008437 ACCCACCCCAGGCAGGAACCTGG No data
1121825769_1121825781 4 Left 1121825769 14:97008400-97008422 CCCCAAAGTGGATTCACCCACCC No data
Right 1121825781 14:97008427-97008449 CAGGAACCTGGAAGTTGTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121825769 Original CRISPR GGGTGGGTGAATCCACTTTG GGG (reversed) Intergenic
No off target data available for this crispr