ID: 1121825780

View in Genome Browser
Species Human (GRCh38)
Location 14:97008426-97008448
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121825770_1121825780 2 Left 1121825770 14:97008401-97008423 CCCAAAGTGGATTCACCCACCCC No data
Right 1121825780 14:97008426-97008448 GCAGGAACCTGGAAGTTGTTTGG No data
1121825771_1121825780 1 Left 1121825771 14:97008402-97008424 CCAAAGTGGATTCACCCACCCCA No data
Right 1121825780 14:97008426-97008448 GCAGGAACCTGGAAGTTGTTTGG No data
1121825769_1121825780 3 Left 1121825769 14:97008400-97008422 CCCCAAAGTGGATTCACCCACCC No data
Right 1121825780 14:97008426-97008448 GCAGGAACCTGGAAGTTGTTTGG No data
1121825767_1121825780 22 Left 1121825767 14:97008381-97008403 CCACTCAGGGCTTGAGTGGCCCC No data
Right 1121825780 14:97008426-97008448 GCAGGAACCTGGAAGTTGTTTGG No data
1121825766_1121825780 23 Left 1121825766 14:97008380-97008402 CCCACTCAGGGCTTGAGTGGCCC No data
Right 1121825780 14:97008426-97008448 GCAGGAACCTGGAAGTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121825780 Original CRISPR GCAGGAACCTGGAAGTTGTT TGG Intergenic
No off target data available for this crispr