ID: 1121827422

View in Genome Browser
Species Human (GRCh38)
Location 14:97021867-97021889
Sequence GTGGACTAGCACGTAGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121827422_1121827430 18 Left 1121827422 14:97021867-97021889 CCCATGTCTACGTGCTAGTCCAC No data
Right 1121827430 14:97021908-97021930 AACTCCCTTATTCCTAGAGGTGG No data
1121827422_1121827431 19 Left 1121827422 14:97021867-97021889 CCCATGTCTACGTGCTAGTCCAC No data
Right 1121827431 14:97021909-97021931 ACTCCCTTATTCCTAGAGGTGGG No data
1121827422_1121827429 15 Left 1121827422 14:97021867-97021889 CCCATGTCTACGTGCTAGTCCAC No data
Right 1121827429 14:97021905-97021927 ATAAACTCCCTTATTCCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121827422 Original CRISPR GTGGACTAGCACGTAGACAT GGG (reversed) Intergenic
No off target data available for this crispr