ID: 1121827780

View in Genome Browser
Species Human (GRCh38)
Location 14:97024817-97024839
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121827780_1121827783 -5 Left 1121827780 14:97024817-97024839 CCTGAACCAAGTTGCATGCCCTG No data
Right 1121827783 14:97024835-97024857 CCCTGCCATCTCTTCTCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121827780 Original CRISPR CAGGGCATGCAACTTGGTTC AGG (reversed) Intergenic
No off target data available for this crispr