ID: 1121827957

View in Genome Browser
Species Human (GRCh38)
Location 14:97026258-97026280
Sequence CAGGCTTACCAAAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121827949_1121827957 0 Left 1121827949 14:97026235-97026257 CCAGGCCTGATCCCTTTGCAAGA No data
Right 1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG No data
1121827948_1121827957 1 Left 1121827948 14:97026234-97026256 CCCAGGCCTGATCCCTTTGCAAG No data
Right 1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG No data
1121827946_1121827957 19 Left 1121827946 14:97026216-97026238 CCTTACGTGTAAAGACTTCCCAG No data
Right 1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG No data
1121827951_1121827957 -5 Left 1121827951 14:97026240-97026262 CCTGATCCCTTTGCAAGACAGGC No data
Right 1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG No data
1121827944_1121827957 30 Left 1121827944 14:97026205-97026227 CCAGGGCCTCTCCTTACGTGTAA No data
Right 1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG No data
1121827945_1121827957 24 Left 1121827945 14:97026211-97026233 CCTCTCCTTACGTGTAAAGACTT No data
Right 1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121827957 Original CRISPR CAGGCTTACCAAAGGGAAGT GGG Intergenic
No off target data available for this crispr