ID: 1121829754

View in Genome Browser
Species Human (GRCh38)
Location 14:97039942-97039964
Sequence GGTCCCAGAAGATCTAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121829754_1121829755 -10 Left 1121829754 14:97039942-97039964 CCTGAATTAGATCTTCTGGGACC No data
Right 1121829755 14:97039955-97039977 TTCTGGGACCCATGAATGTCTGG No data
1121829754_1121829761 2 Left 1121829754 14:97039942-97039964 CCTGAATTAGATCTTCTGGGACC No data
Right 1121829761 14:97039967-97039989 TGAATGTCTGGGTTATCTTGGGG No data
1121829754_1121829762 5 Left 1121829754 14:97039942-97039964 CCTGAATTAGATCTTCTGGGACC No data
Right 1121829762 14:97039970-97039992 ATGTCTGGGTTATCTTGGGGTGG No data
1121829754_1121829763 16 Left 1121829754 14:97039942-97039964 CCTGAATTAGATCTTCTGGGACC No data
Right 1121829763 14:97039981-97040003 ATCTTGGGGTGGCTGTGTTGAGG No data
1121829754_1121829760 1 Left 1121829754 14:97039942-97039964 CCTGAATTAGATCTTCTGGGACC No data
Right 1121829760 14:97039966-97039988 ATGAATGTCTGGGTTATCTTGGG No data
1121829754_1121829759 0 Left 1121829754 14:97039942-97039964 CCTGAATTAGATCTTCTGGGACC No data
Right 1121829759 14:97039965-97039987 CATGAATGTCTGGGTTATCTTGG No data
1121829754_1121829756 -9 Left 1121829754 14:97039942-97039964 CCTGAATTAGATCTTCTGGGACC No data
Right 1121829756 14:97039956-97039978 TCTGGGACCCATGAATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121829754 Original CRISPR GGTCCCAGAAGATCTAATTC AGG (reversed) Intergenic
No off target data available for this crispr