ID: 1121829756

View in Genome Browser
Species Human (GRCh38)
Location 14:97039956-97039978
Sequence TCTGGGACCCATGAATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1121829754_1121829756 -9 Left 1121829754 14:97039942-97039964 CCTGAATTAGATCTTCTGGGACC No data
Right 1121829756 14:97039956-97039978 TCTGGGACCCATGAATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1121829756 Original CRISPR TCTGGGACCCATGAATGTCT GGG Intergenic
No off target data available for this crispr